Class org.broadinstitute.hellbender.tools.funcotator.ProteinChangeInfoUnitTest

21:18:34.102 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.102 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.102 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
21:18:34.103 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.103 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.103 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.103 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.103 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.103 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.103 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.104 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
21:18:34.104 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.104 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
21:18:34.105 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.105 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.105 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
21:18:34.105 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.105 WARN  FuncotatorUtils - Unexpected codon sequence: TNT   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.105 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.106 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.106 WARN  FuncotatorUtils - Unexpected codon sequence: NTA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.106 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.106 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.106 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.106 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.106 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.106 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.107 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.107 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.107 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.107 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.107 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.107 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.107 WARN  FuncotatorUtils - Unexpected codon sequence: NTA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: NCA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: TNT   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: TNC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.108 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
21:18:34.109 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, ref allele: A)
21:18:34.109 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.109 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.109 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, alt allele: ATCACTG)
21:18:34.109 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.109 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.109 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATGGAGGACGACTCACTCTACTTGGGAGGTGAGTGGCAGTTCAACCACTTTTCAAAACTCACATCTTCTCGGCCCGATGCAGCTTTTGCTGAAATCCAGCGGACTTCTCTCCCTGAGAAGTCACCACTCTCATGTGAGACCCGTGTCGACCTCTGTGATGATTTGGCTCCTGTGGCAAGACAGCTTGCTCCCAGGGAGAAGCTTCCTCTGAGTAGCAGGAGACCTGCTGCGGTGGGGGCTGGGCTCCAGAATATGGGAAATACCTGCTACGTGAACGCTTCCTTGCAGTGCCTGACATACACACCGCCCCTTGCCAACTACATGCTGTCCCGGGAGCACTCTCAAACGTGTCATCGTCACAAGGGCTGCATGCTCTGTACGATGCAAGCTCACATCACACGGGCCCTCCACAATCCTGGCCACGTCATCCAGCCCTCACAGGCATTGGCTGCTGGCTTCCATAGAGGCAAGCAGGAAGATGCCCATGAATTTCTCATGTTCACTGTGGATGCCATGGAAAAGGCATGCCTTCCCGGGCACAAGCAGGTAGATCNNNNNNN
21:18:34.110 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, ref allele: A)
21:18:34.110 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.110 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.110 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.110 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
21:18:34.110 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATGGAGGACGACTCACTCTACTTGGGAGGTGAGTGGCAGTTCAACCACTTTTCAAAACTCACATCTTCTCGGCCCGATGCAGCTTTTGCTGAAATCCAGCGGACTTCTCTCCCTGAGAAGTCACCACTCTCATGTGAGACCCGTGTCGACCTCTGTGATGATTTGGCTCCTGTGGCAAGACAGCTTGCTCCCAGGGAGAAGCTTCCTCTGAGTAGCAGGAGACCTGCTGCGGTGGGGGCTGGGCTCCAGAATATGGGAAATACCTGCTACGTGAACGCTTCCTTGCAGTGCCTGACATACACACCGCCCCTTGCCAACTACATGCTGTCCCGGGAGCACTCTCAAACGTGTCATCGTCACAAGGGCTGCATGCTCTGTACGATGCAAGCTCACATCACACGGGCCCTCCACAATCCTGGCCACGTCATCCAGCCCTCACAGGCATTGGCTGCTGGCTTCCATAGAGGCAAGCAGGAAGATGCCCATGAATTTCTCATGTTCACTGTGGATGCCATGGAAAAGGCATGCCTTCCCGGGCACAAGCAGGTAGATCNNNNNNN