The Sierra Mixe maize varieties cultured locally—referred to as Rojo, Piedra Blanca, and Llano—share similar plant morphologies, growing to a height of over 5 meters and exhibiting extensive aerial root formation at each node. We compared the development of aerial roots in the Sierra Mixe maize with another tall maize variety, Hickory King (Fig 1A). Unlike most modern maize varieties in which aerial root formation ceases after the juvenile-to-adult transition (arrow, Fig 1A), aerial root formation in Sierra Mixe maize continued well after this transition, resulting in a 3- to 4-fold greater number of aerial roots (Fig 1B). Approximately midway through development (July to September), these maize aerial roots secrete significant amounts of mucilage that is rich in arabinose, fucose, and galactose when moisture is available (Fig 2). The sugars comprise a complex polysaccharide that presumably contributes to the viscosity of the mucilage and may be disassembled to provide monosaccharides to support microbial growth and metabolism. Mucilage produced by underground maize roots also contain high levels of fucose and arabinose [32], although at approximately one-half the concentration found in aerial root mucilage.

The microbiota associated with the underground and aerial roots, stems, and aerial root mucilage of Sierra Mixe maize grown in Sierra Mixe was investigated by amplifying and sequencing of 16S rRNA genes and by shotgun metagenome sequencing. The rhizosphere samples were the most diverse, and among plant samples, the aerial root mucilage had the highest diversity (S1 Fig) and a higher relative abundance of bacteroidetes and proteobacteria (beta and gamma) compared to other parts of the plants (S2 Fig). Many of the lineages that are overrepresented in mucilage include known plant-associated nitrogen fixers. A comparison of samples based on the total community composition showed a clustering of mucilage samples that were statistically distinct from the rest of the plant and rhizosphere samples (Fig 3A). Clustering of samples based upon the variance-stabilized abundance of sequence variants again indicates that while the rhizosphere samples were distinct and diverse, the mucilage samples were distant from the other plant tissues (S3 Fig). The complete list of all sequence variants identified in the Sierra Mixe maize and soil samples can be found at (DOI: 10.6084/m9.figshare.4789759). Additionally, the metagenomic data was searched for homologs of the 6 core nif genes as described by Dos Santos and colleagues [33]. This search revealed the presence of all 6 core nif genes in the metagenomes from mucilage and rhizosphere and only a subset of the 6 core nif genes from stem tissue (Fig 3B). A higher normalized abundance of most nif genes (except nifD) in mucilage than stem tissues suggests that the mucilage may be enriched in nitrogen-fixing microbes.

To assess the possibility that mucilage harbored a diazotrophic microbial community, the mucilage was tested for nitrogenase activity using ARAs [34] and by incorporation of ¹⁵N₂ gas. ARA was used to assess leaves, stems, underground roots, aerial roots (with and without mucilage), and mucilage collected from Sierra Mixe maize plants grown either in Sierra Mixe, Mexico, or Madison, USA. No ARA activity was detected in underground roots, leaves, stems, or even aerial roots before mucilage production (S4 Fig). In contrast, significant ARA activity was detected in aerial roots harboring mucilage (S4 Fig) and in isolated mucilage from plants grown in either Sierra Mixe or Madison (Fig 4A). The ARA activity in mucilage isolated from Sierra Mixe maize that was grown in Madison suggests either that the Sierra Mixe maize seeds carry an endogenous inoculum of nitrogen-fixing bacteria or that Sierra Mixe maize can recruit adequate nitrogen-fixing bacteria from local environments. Nitrogen fixation by mucilage samples was also measured by direct incorporation of ¹⁵N₂ in mucilage samples collected from Sierra Mixe maize (Fig 4B).

As with Sierra Mixe maize, a wild relative, Z. mays ssp. mexicana (teosinte), also produced extensive aerial roots (S5 Fig) but much smaller amounts of secreted mucilage. To test the ability of the teosinte mucilage to support nitrogen fixation, we collected mucilage from several plants of teosinte and measured endogenous nitrogenase activity using ARA. Acetylene reduction was readily observed in teosinte mucilage (Fig 4A), suggesting that production of mucilage that supports nitrogen fixation by an associated nitrogen-fixing microbiota may be an ancient trait of maize and potentially introgressed from Z. mays ssp. mexicana into the Sierra Mixe landrace postdomestication.

To assess the mucilage characteristics that support nitrogen fixation, we tested the ability of 2 phylogenetically distinct nitrogen-fixing bacteria to reduce acetylene when inoculated in the mucilage collected from aerial roots of Sierra Mixe maize. Before the experiment, the mucilage was frozen for 2 weeks at –80 °C and thawed, which abolished endogenous nitrogenase activity (Fig 4C). Two nitrogen-fixing bacteria, H. seropedicae, and A. brasilense, showed readily detectable ARA activity when added to the mucilage (Fig 4C and 4D). Bacterial nitrogenase is O₂-sensitive and needs to be protected by a low-oxygen (<5%) environment or physiological protective mechanisms, as well as an abundant carbon source to derive energy for this process [35]. To determine if mucilage could fulfill these requirements, we measured the free-oxygen concentration in the mucilage of Sierra Mixe maize and teosinte at the depth of 8 mm and found it to be <5%, indicating that the mucilage can provide a microaerobic environment compatible with nitrogen fixation for these bacteria [36] (Fig 4D). Mucilage is also comprised of complex sugars that may be catabolized to provide free sugars—mainly arabinose, fucose, and galactose—capable of supporting bacterial growth and nitrogen fixation. To determine whether these properties of the mucilage are sufficient to support nitrogen fixation, we created an artificial medium mimicking these mucilage properties by using a low-N medium, solidified with 0.2% agar, that reduced oxygen concentration to levels almost as low as those found in the mucilage (S6A Fig) and supplemented with a mix of free sugars corresponding to the composition of the fully hydrolyzed mucilage carbohydrates. H. seropedicae, A. brasilense, and Burkholderia unamae (S6B, S6C and S6D Fig) showed significant ARA activity in this reconstructed mucilage, indicating that the low O₂ and free sugars provided by the aerial root mucilage are sufficient to support nitrogen fixation by these diazotrophs.

Based on ARA, we can conclude that mucilage from Sierra Mixe maize harbors native diazotrophs and can also support the N₂-fixing activity of the exogenously inoculated diazotrophs, H. seropedicae, A. brasilense, and B. unamae. However, these data did not demonstrate that the aerial roots had the capacity to take up and assimilate the fixed N. To test whether atmospheric N₂ that was fixed by mucilage-associated diazotrophs could be transferred to and utilized by the Sierra Mixe maize, a more direct ¹⁵N₂ gas–enrichment experiment was used. Aerial roots, along with their generated mucilage, inoculated with A. brasilense Sp7 exhibited significant ¹⁵N₂ gas incorporation in comparison to the ¹⁴N₂ gas-treated roots (Fig 5), and isotope-ratio mass spectrometry (IRMS) analysis confirmed significant enrichment of ¹⁵N in chlorophyll (converted to pheophytin for analysis) of these roots compared to the negative controls (Fig 5).

The transfer of ¹⁵N₂ from mucilage to the aerial root tissue and chlorophyll demonstrated the potential of this diazotrophic community to contribute to the nitrogen nutrition of the plant, but a major question of this study is whether the mucilage-associated diazotrophic microbiota served to transfer fixed nitrogen to fulfill, at least in part, the reduced nitrogen requirements of Sierra Mixe maize under field conditions. The contribution of atmospheric nitrogen fixation to Sierra Mixe maize was first estimated in the field using natural abundance ¹⁵N measurements [37,38]. This method relies on the relative abundance of the stable isotope ¹⁵N in the atmosphere and soil, with ¹⁵N abundance being more abundant in the soil than in the air. As a consequence, plants that derive N from the atmosphere will exhibit reduced δ¹⁵N levels when compared to reference nonfixing plants. In 2006, samples of Sierra Mixe maize and reference plants from the Asteraceae and Ranunculaceae (families with no known nitrogen-fixing members) growing near each other were collected from each of 2 fields. In this preliminary experiment, Sierra Mixe maize δ¹⁵N was significantly lower than the reference plants, indicating the assimilation of atmospheric nitrogen (S1 Table). In 2010, 2011, and 2012, the methods from [38,39] were used in experiments in Sierra Mixe by sampling reference species of non-nitrogen-fixing plants growing near the Sierra Mixe maize plants and a conventional maize variety, Maiz Blanco Conasupo. In addition to determining δ¹⁵N from each maize and reference plant sample, leaf samples of each reference plant were used for 18S rRNA sequence analysis to identify the reference species (Table 1A). The δ¹⁵N values of Sierra Mixe maize grown in the field in Sierra Mixe were determined at a single developmental time point in 2010 and at 5 developmental time points in 2011 and 2012. In 2010, the δ¹⁵N values for the Sierra Mixe maize were significantly lower than those of the reference plant species and of the conventional maize variety, Maiz Blanco Conasupo (Table 1A), indicating that the Sierra Mixe maize was able to derive a significant part of its tissue nitrogen from atmospheric dinitrogen. Similar δ¹⁵N values from root and leaf samples also showed that the leaf samples analyzed were representative of the whole plant (S2 Table). In 2011 and 2012, the δ¹⁵N values of Sierra Mixe maize were significantly lower than the reference plants at 4 of the 5 developmental time points, suggesting that Sierra Mixe maize derived a portion of its tissue nitrogen from atmospheric nitrogen (Table 1B). The calculated percent of nitrogen derived from the atmosphere (%Ndfa) from the δ¹⁵N values in Table 1 ranged between 30% and 80% (S7 Fig).

The method of using natural abundance ¹⁵N and other species as reference plants to calculate %Ndfa is potentially limiting because of differences in root and shoot growth and phenology of reference and test plants and the limited range of δ¹⁵N found in soils. An alternative method, ¹⁵N enrichment, is similar to the natural abundance methods but enriches soil ¹⁵N by the addition of ¹⁵N fertilizer, thereby increasing the difference between soil and atmospheric δ¹⁵N and assay sensitivity. Several direct comparisons have indicated that both methods can give comparable but slightly different results [38,40].

Another method of estimating N₂ fixation is the “N Difference” method, which determines the difference between the total N content of an N₂-fixing plant and the total N content of a reference nonfixing plant. Total N is calculated by multiplying total N content (%) in a specific plant sample and the total biomass (kg/ha or kg) produced by the plant. The %Ndiff is calculated as described in Materials and methods.

In 2016 and 2017, we assessed atmospheric nitrogen fixation using the ¹⁵N-isotope-enrichment method (1%–10% enrichment) at 3 vegetative growth stages—V9, V12, and Tassel—[41] in a random complete block design (5 replicates) in 3 low-N Sierra Mixe fields and at Tassel stage in 2017 in the same fields using the same design (Table 2). Field 3 (with a history of 0–1 year of maize production) yielded significant differences in Atom% ¹⁵N only for SM2 at the Tassel stage in 2016, but shoot N was significantly different in both 2016 and 2017. In 2016, Sierra Mixe maize landrace varieties exhibited significantly lower Atom%¹⁵N levels than the reference plants in Field 4, (with a history of 1–2 years of maize production) at Tassel and at V9 in 2016, and at Tassel in both years for shoot N. In both 2016 and 2017, Sierra Mixe maize landraces in Field 5 (over 3 years of continuous maize production) exhibited significantly lower Atom%¹⁵N and shoot N at all stages sampled, indicating a significant level of atmospheric nitrogen fixation in those experiments. The calculated %Ndfa ranged between 31% and 55%, and Ndiff ranged from 29%–82%. The correlation between Ndfa and Ndiff was 0.55 and 0.44 (P < 0.01) across locations in 2016 and 2017, respectively. Significant measures of N₂ fixation were detected in 4 of 6 experiments by Atom% δ¹⁵N N determinations (Ndfa) and in 6 of 6 experiments by Ndiff determinations. Root and shoots exhibited significant differences in biomass, height, and stem diameter between control hybrids and local landraces (S4 Table). Soil analyses (S5 Table) showed that all sites were depleted in soil nitrogen yet produced a crop greater than 2,000 kg/ha. It is possible that differences between microbiota associated with the 3 fields in different stages of crop rotation (0 to >4 years of continuous maize production) account for differences observed among fields and between years, but further research is needed to answer this question.

Sierra Mixe maize seeds were obtained in Sierra Mixe region of Oaxaca, Mexico, from an open pollinated population. Z. mays ssp. mexicana (teosinte), LH123HT, Mo17, PHG39, LH82, PH207, and B73 seeds were obtained from USDA National Plant Germplasm System (NPGS) (accessions Ames 8083, PI601079, PI558532, PI600981, PI601170, PI601005, and PI550473, respectively). Maize line Hickory King was obtained from Victory Seeds (accession 3140041). Tornado-F21 and H-377 were obtained from Semillas Ceres in Oaxaca. SM1 and SM2 are different selections from the Sierra Mixe landrace. SM1 is a uniform population based on kernel size, shape, and color, and SM2 is a heterogeneous population representing the landrace.

Biological materials were accessed and utilized under an Access and Benefit Sharing Agreement between the Sierra Mixe community and BioN2, Inc., and with permission from the Mexican government. An internationally recognized certificate of compliance under the Nagoya Protocol (ABSCH-IRCC-MX-207343-3) has been issued for such activities.

A. brasilense Sp7 and B. unamae MTI-641 were kindly provided by Dr. G. Alexandre (University of Tennessee, Knoxville, USA) and Dr. A. Hirsch (University of California, Los Angeles, USA), respectively. H. seropedicae Z152 (ATCC 35894) was provided by the ATCC (http://www.atcc.org/). Bacteria were grown in liquid BSE medium.

The rhizosphere and plant tissues that include stem, leaf, aerial roots, underground roots, and mucilage of Sierra Mixe maize were sampled during seasons 2010, 2011, and 2012 from Fields 1 and 2 in Sierra Mixe. For plant endophyte analysis, tissues were surface sterilized by rinsing with mqH₂O, shaken gently in 70% ethanol for 5 minutes, placed into 1% hypochlorite bleach, gently stirred for 10 minutes, rinsed 3 times in mqH₂0, and dried in a laminar flow cabinet. Roots and stems were also dissected to remove epidermal tissues before extraction. For seed endophyte analysis, embryo and endosperm of Sierra Mixe, Hickory King, and B73 were withdrawn from the seeds by hand using a razor blade in a laminar flow cabinet and were collected in 1.5 ml sterile microcentrifuge tubes. For this study, the rhizosphere was defined as a layer of soil covering the outer surface of the root system that could be washed from roots in a buffer/detergent solution. Roots were first separated and shaken to remove loosely adhering soil. All soils and plant material samples were used immediately for DNA extraction. Soil fertility analysis, which included physical parameters, soil reaction, and salinity, was performed in AgroLab (Pachuma, Mexico).

The number of nodes with aerial roots was monitored weekly (greenhouse) or after 14 weeks (field). The total number of aerial roots was quantified after 14 weeks. The disappearance of leaf wax and appearance of trichomes were monitored weekly to determine the transition between juvenile stage and adult stage in Sierra Mixe and Hickory King maize.

For experiments in the greenhouse, seeds of Sierra Mixe of Fields 1 and 2 and Hickory King were surface sterilized and germinated as described previously. After 1 week, the seedlings are transplanted in 40-liter pots filled with a mix of sand and perlite (v:v) and grown in a high-ceiling greenhouse at the Biotron facility (University of Wisconsin, Madison, USA). Plants were watered twice a day for 2 minutes with half-strength of Hoagland solution. For experiments in the field, 3 independent plots of 20 plants per genotype were planted, with 3 border rows (B73) between each genotype. Sierra Mixe and Teosinte plants that were grown in Madison for the ARA were planted in the same field at the same time. This experiment was replicated in 3 different field plots.

Glycosyl composition analysis was performed by combined gas chromatography/mass spectrometry (GC/MS) of the per-O-trimethylsilyl (TMS) derivatives of the monosaccharide methyl glycosides produced from the sample by acidic methanolysis. Methyl glycosides were first prepared from dry mucilage samples by methanolysis in 1 M HCl in methanol at 80 °C (18–22 hours), followed by re-N-acetylation with pyridine and acetic anhydride in methanol (for detection of amino sugars). The samples were then per-O-trimethylsilylated by treatment with Tri-Sil (Pierce) at 80 °C (0.5 hours). GC/MS analysis of the TMS methyl glycosides was performed on an HP 6890 GC interfaced to a 5975b MSD, using an All Tech EC-1 fused silica capillary column (30 m × 0.25 mm ID). The analysis was performed at the Complex Carbohydrate Center Research Center (CCRC) of University of Georgia, Athens, USA.

DNA (80–150 ng μl⁻¹) was extracted from 100 mg of the rhizosphere plant tissues using a DNA isolation kit (Mo Bio Laboratories, Carlsbad, USA). The PCR control for microbial DNA isolation was performed on 16S rRNA genes. PCR was performed using eubacterial primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′), and the product was approximately a 1,450 bp fragment. Amplification was carried out with 1 μM of each primer in 3 mM MgCl₂, 20 μM of each dNTP, 1.25 units of Taq polymerase (Promega) in a total volume of 20 μl of 1X reaction buffer (Promega, Madison, USA). PCR conditions included an initial denaturation at 95 °C for 3 minutes followed by 35 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute, and elongation at 72 °C for 1.5 minutes, with a final elongation at 72 °C for 7 minutes. DNA was resolved using an agarose gel run at 100 V for 30 minutes for analysis of total DNA and amplification of PCR products, respectively. Gels were visualized by ethidium bromide staining under UV light in a gel documentation system. The products obtained were purified with a NucleoSpin Gel extraction kit (Clontech, Palo Alto, USA).

16S rRNA gene PCR and sequencing of rhizosphere and plant tissues were carried out using the Caporaso protocol [45]. We extended the Caporaso approach [46] to a dual barcode scheme for each sample and replaced the Golay barcodes with a different set of Illumina-compatible barcodes that were designed to balance base composition and tolerate up to 4 sequencing errors in barcode sequences. The forward primer used was AATGATACGGCGACCACCGAGATCTACAC[Barcode]TATGGTAATTGTGTGCCAGCMGCCGCGGTAA, and the reverse primer was CAAGCAGAAGACGGCATACGAGAT[Barcode]AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT. The barcodes used were designed to allow pooling of multiple samples within a single MiSeq run. Ten cycles of PCR with barcoded primers were performed at low annealing temperature (55 °C); samples were then pooled and cleaned using a Qiagen column to remove the unincorporated primers. At this stage, an additional 10 or 20 cycles of PCR were performed on the pool using the Illumina paired-end flowcell primers with a higher annealing temperature (65 °C). The resulting PCR product was subjected to QC with an Agilent Bioanalyzer and estimated concentration using KAPA Biosystems qPCR kit. The samples were diluted to the appropriate loading concentration for a MiSeq run, spiked with 25% phiX control library, and sequenced using an Illumina MiSeq instrument with the manufacturer’s standard 150 nucleotides paired-end dual-index sequencing protocol and the custom sequencing primers.

The Illumina sequences were obtained from 2 MiSeq runs (2X150 bp paired-end) and were demultiplexed using a custom script (https://figshare.com/s/04997ae7f7d18b53174a). The 822,804 reads thus obtained were trimmed to a Phred-equivalent of 20 and filtered for adaptor contamination using BBDuk (of the BBTool packages https://sourceforge.net/projects/bbmap/). Because of the low quality of the reverse mate pair, reads of the forward mate were used in the analysis. The reads were then preprocessed and analyzed using DADA2 [47]. Prescribed standard filtering parameters were used, such as PhiX contamination check and removal of reads with more than 2 errors or ambiguous bases or with an expected error greater than 2. Chimeras were identified and removed using the removeBimeraDenovo function of DADA2. The clean reads were then collapsed into sequence variants and classified using RDP training set (version 14). The sequence variants that were classified as chloroplast or mitochondria were removed from further analyses. From samples with library size ranging from 84 to 20,597 reads (mean of 4,703), 995 unique sequence variants were identified.

Alpha and Beta diversity metrics were generated using the Phyloseq 3.4.2 R packages [48]. Alpha diversity was calculated using Shannon and Simpson indices. Additionally, a PCoA plot based upon Bray-Curtis dissimilarity matrix was used to visualize the differences in samples. The sequence variant table was used to generate a heat map following the variance-stabilizing transformation in DESeq2 [49]. Permanova tests were run using the adonis function from the vegan 3.4.3.R package (https://CRAN.R-project.org/package=vegan) performed on the NMDS ordination.

Illumina sequencing libraries from the same DNA extractions as above were made using an adaptation of the Nextera transposase-based library construction method with multiplex barcoding. Samples were then sequenced on the MiSeq and HiSeq instruments. Illumina sequences thus obtained were demultiplexed and trimmed using Trimmomatic (ver 0.33) [50] with the following parameter: Illuminaclip 2:30:10, Headcrop:15, Leading:20, Trailing:20, Sliding window:4:20, and Minlen:100. The reads were then screened for PhiX and maize sequences (genomic, chloroplast, and mitochondrial) using Bowtie2 aligner [51] against the PhiX genome (Genbank acc# NC_001422.1) and Z. mays cultivar B73 draft genome (RefSeq assembly acc# GCF_000005005.2). The clean reads were assigned taxonomy using Kaiju [52] with the nr database. To calculate the beta diversity of the samples, we used Phylosift (ver 1.0.1) [53], which identifies and places reads matching 37 conserved phylogenetic marker genes on a reference tree. From these placements, an Edge-PCA analysis [54] was carried using Guppy [54].

Peptide sequences of the 6 core nif genes (nifH, nifD, nifE, nifK, nifN, nifB) and alternate nitrogenase (anfG, vnfG) from known diazotrophs as previously published [33] were retrieved from GenPept as a reference. A multiple-sequence alignment of these sequences was generated as a reference alignment using ClustalW2 [55]. A blast search (E-value < 0.001) of 6 frame-translated metagenomic reads was conducted against these reference sequences. The hits were then aligned against the multiple sequences alignment of reference using clustal-Omega [56] followed by generation of phylogenetic trees for every individual nif gene, using Fasttree2.1 [57] with a WAG model of amino acid evolution and gamma20 likelihood. The reads were assigned as belonging to the nif genes if they were inside the clade of the reference sequences. Each read that had significant similarity to one of the core nif genes was further analyzed by phylogenetic analysis to confirm its assignment as one of the 6 core nif genes. The counts of nif genes thus obtained were normalized by recA counts (determined using recA TIGRFAM HMM [58] with HMMER3 and an E-value cutoff of e⁻¹⁰).

For ARA with the mucilage, 2 ml of freshly collected mucilage from 1 or 2 aerial roots (Sierra Mixe) or several plants (teosinte) grown in the field were introduced in 14.5 ml vials (Wheaton, Millville, USA) that were tightly closed. For ARA with added bacteria, A. brasilense, H. seropedicae, and B. unamae were grown in BSE medium for 48 hours. Then, bacteria were collected by centrifugation (5 minutes, 4,000 × g) and suspended in the Fahraeus medium. The 14.5 ml vials, each containing 5 ml of mucilage previously stored for several months at –20 °C to reduce endogenous nitrogen-fixing bacteria, were inoculated with the bacterial suspension at a final OD_600nm = 0.01. Control tubes were prepared either without bacteria or with 5 ml of Fahraeus medium instead of mucilage. Then, 850 μl of acetylene (Airgas) was injected into each vial. OD_600nm was measured for each tube after 72 hours. For both conditions, controls without acetylene were performed in parallel. For ARA with aerial roots, 1 aerial root without mucilage was introduced in each 14.5 ml vial (10 replicates). One ml of acetylene (Airgas) was injected into each vial. For ARA with seedlings, Sierra Mixe seedlings were inoculated with A. brasilense and grown for 3 weeks. Plants were then transferred to 500 ml jars, and 50 ml of acetylene was injected in each jar. For ARA with underground roots, pieces of roots (about 10 cm long) were collected from plants grown in pots and introduced into 14.5 ml vials (3 replicates). Ethylene quantification was made by injecting 1 ml of the air phase, sampled after 72 hours, on a gas chromatography (GC-2010 Shimadzu) equipped with a Rt-Alumina BOND/KCL column (Restek).

The enrichment of mucilage in ¹⁵N atom was achieved by removing 4 ml of headspace gas and replacing it with 4 ml of either ¹⁵N₂ (Sigma-Aldrich) or ¹⁴N₂ nitrogen gas directly into a vial containing 1.0 mL of mucilage. Mucilage was collected from Sierra Mixe maize plants grown in Sierra Mixe and stored at 4 °C for up to 2 weeks between sampling and the determination of ¹⁵N₂ assimilation. The mucilage samples were incubated at 37 °C for 0 and 70 hours in the presence of ¹⁵N₂. ¹⁵N₂ assimilation was stopped by freezing the mucilage samples at −20 °C. The samples were then freeze-dried and weighed. The ¹⁵N₂ analysis in the mucilage samples was performed at the UC Davis Stable Isotope Facility (Davis, USA) and the UW-Madison Soil Science Facility (Madison, USA). Statistical analysis was performed using SYSTAT version 10 (Chicago, USA).

For measurement in collected mucilage, 2 ml of mucilage was introduced in a 15 ml tube. The probe (robust oxygen mini probe, Pyroscience) was introduced 8 mm deep in the mucilage and oxygen measurements performed until stabilization of the signal was observed. Control corresponds to free-oxygen concentration in the liquid Fahraeus medium. One-point calibration was made in aerated water, as advised by the manufacturer.

Aerial roots were collected from Sierra Mixe maize grown at the Biotron greenhouse facility (University of Wisconsin, Madison, USA). Mucilage was generated from each of these aerial roots by incubating them in 5 ml of water at room temperature for 48 hours. Mucilage, along with the aerial roots, was inoculated with A. brasilense Sp7. Then, 10%–15% (v/v) of ¹⁵N₂ gas was pumped into the vials, and the samples were incubated at 30 °C for 48 hours. After incubation of mucilage alone, or aerial roots alone, pheophytin extracted from these aerial roots was subjected to IRMS analysis. To obtain pheophytin, chlorophyll was extracted from aerial roots and converted to pheophytin by acid treatment, following as described [59]. ¹⁴N₂-treated mucilage and aerial roots were used as negative controls.

The proportion (%) of nitrogen derived from biological nitrogen fixation (%Ndfa) was estimated from the ¹⁵N natural abundance (expressed in delta units, ‰) of the Sierra Mixe maize (δ¹⁵N_{fixing plant}) and that of the reference plant species (δ¹⁵N_ref). In each of the 2011 and 2012 field seasons in Sierra Mixe, 90–114 individual maize samples (depending on the year) and 270 reference plant samples, representing 8–10 species (depending on the year) of non-nitrogen-fixing plants, were analyzed. For the single time point in 2010, 12 individual maize samples and 33 reference plant samples, representing 8 species of non-nitrogen-fixing plants, were analyzed. The reference plant species in the field were identified using universal 18S PCR analysis from DNA sampled using FTA Plant Saver card (GE Life Sciences, Pittsburg, USA) simultaneously with tissue samples collected for ¹⁵N analysis. PCRs were performed using Sigma’s Extract-N-Amp Plant PCR Kit according to the manufacturer for sequencing and BLASTN comparison. For ¹⁵N natural abundance, the third-youngest leaf of Sierra Mixe maize or reference plants was collected from Field 3 and 4 from the second to the sixth month postplanting and analyzed for N-isotope composition. Total organic nitrogen was determined by Kjeldahl digestion followed by steam distillation. Analysis for natural ¹⁵N abundance was carried out as described by Bremer and van Kessel [38]. The ¹⁵N analysis was performed at UCD Stable Isotope Facility (http://stableisotopefacility.ucdavis.edu/13cand15n.html). The percentage of nitrogen derived from nitrogen fixation (%Ndfa) was calculated as follows: %Ndfa=δ15Nreference−δ15Nfixingplantδ15Nreference−BX100, where “δ¹⁵N” is stable nitrogen isotopes, “ref” is the value from non-N-fixing reference plants, “fixing plant” is Sierra Mixe maize, and “B” is the ¹⁵N abundance in the air, assumed to be 0.0‰.

In 2016, 3 locations were chosen: Field 3, land that had not been planted to crops for over 10 years; Field 4, land that had maize for 1 year; and Field 5, land with continuous maize. A randomized complete block design trial was established at each site, with 5 replicates with 4 varieties. Each plot consisted of 6 matas surrounded by a common border of SM2 on all sides and a double border on outside rows. A mata is the traditional planting design in the Sierra Mixe region, similar to a hill plot in which multiple plants are seeded together. Each mata was planted with 5 seeds and thinned to 3 seeds for 18 plants per plot. Matas were planted in a grid 80 × 100 cm from each other. ¹⁵N was applied at a dose of 0.36 grams per plot in a liquid solution, reaching the desired enrichment of 1% for all 3 fields, with 50 ml added per mata.

In 2017, the same 3 locations were planted with same design and entries, except Field 3 consisted only of H377 and SM2 entries. In all 3 fields, ¹⁵N was applied at a dose of 0.95 grams per plot, reaching the desired enrichment of greater than 1%. A solution was spread evenly over each plot using a garden watering can, such that the whole experimental area received an equal amount of enriched ¹⁵N. Plants were covered with plastic bags at the time of application (V5) to ensure that ¹⁵N was not directly applied to the leaves and that the ¹⁵N was uniformly available to all plants.

Soil samples were taken from a 0–60 cm depth in each plot, blended, and sent for analysis at UC Davis Soil lab. Means were calculated across locations. In 2016, at V9 and V12, 1 mata (3 plants) was sampled; and at Tassel, 4 matas (12 plants) were sampled. In 2017, a single sampling of 6 matas (18 plants) was sampled at Tassel. For each sampling, plants were dug out to include all roots. Because of the high rainfall (2,100 mm concentrated in the growing season from June to October), roots were shallow for both reference and test varieties. Each plant was photographed, and data were recorded for the number of plants, plant height, the total fresh weight of shoots, and roots and stem diameter. Whole plants were chopped, ground, subsampled, and dried in an oven to record total dry weight for shoots and roots. Well-blended subsamples were taken and shipped to Davis to measure Total N and ¹⁵N. Total nitrogen and Atom% ¹⁵N were determined for each plot at each time point for the shoot. Total organic nitrogen was determined by Kjeldahl digestion followed by steam distillation. The ¹⁵N analysis was performed at UCD Stable Isotope Facility (http://stableisotopefacility.ucdavis.edu/13cand15n.html).

%Ndfa was calculated using the ¹⁵N-enrichment method [40] as %Ndfa=(1−Atom%15Nexcess(N2fixer)Atom%15Nexcess(reference))X100. Atom% excess is calculated with sample value obtained from the UC Davis Stable Isotope Facility– 0.37 (n in air).

Nitrogen difference (%NDiff) method was calculated as %Ndiff=Nkg/ha(N2fixer)-Nkg/ha(reference)kgN/ha(reference)X100.

The average of Tornado F21 and H377 was used as the reference to calculate %Ndfa and %Ndiff. For Ndiff calculations, the area harvested was adjusted based on matas harvested at each time point.

Data were analyzed using the R lme4 package. Data were checked for outliers and subjected to ANOVA and mean separation using Least Significant Difference (p = 0.05) for each location. LSDs were calculated only when ANOVA F-tests were significant at p = 0.05. For %Ndfa and %Ndiff, single-degree-of-freedom contrasts were calculated to compare test varieties to the mean of the reference varieties (P > 0.05). Pearson correlation coefficients were calculated between %Ndfa and %Ndiff.