PLoS Genet plos plosgen PLOS Genetics 1553-7390 1553-7404 Public Library of Science San Francisco, CA USA 10.1371/journal.pgen.1005481 PGENETICS-D-15-01932 Correction Correction: The Nutrient-Responsive Hormone CCHamide-2 Controls Growth by Regulating Insulin-like Peptides in the Brain of Drosophila melanogaster Sano Hiroko Nakamura Akira Texada Michael J. Truman James W. Ishimoto Hiroshi Kamikouchi Azusa Nibu Yutaka Kume Kazuhiko Ida Takanori Kojima Masayasu 22 9 2015 9 2015 11 9 e1005481 2015 Sano et al This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited The Nutrient-Responsive Hormone CCHamide-2 Controls Growth by Regulating Insulin-like Peptides in the Brain of Drosophila melanogaster

In the Materials and Methods section, primer sequences for quantitative RT-PCR of the CCHa2 gene are incorrect; the correct sequences are as follows.

CCHa2 forward: GCCTACGGTCATGTGTGCTAC

CCHa2 reverse: ATCATGGGCAGTAGGCCATT

Reference Sano H, Nakamura A, Texada MJ, Truman JW, Ishimoto H, Kamikouchi A, et al. (2015) The Nutrient-Responsive Hormone CCHamide-2 Controls Growth by Regulating Insulin-like Peptides in the Brain of Drosophila melanogaster. PLoS Genet 11(5): e1005209. doi:10.1371/journal.pgen.1005209 26020940