#SampleID	BarcodeSequence	LinkerPrimerSequence	LAB_PERSON_CONTACT	SAMP_COLLECT_DEVICE	PROJECT_SPECIFIC_SITE	SOURCE_ENV	Env	SourceSink	KELLEY_OFFICE_SITE	ASSIGNED_FROM_GEO	RUN_DATE	TITLE	COMMON_SAMPLE_SITE	RUN_PREFIX	AGE	INVESTIGATION_TYPE	ENVIRONMENT	ANATOMICAL_SAMPLE_SITE	STATION	TOT_ORG_CARB	INCLUDES_TIMESERIES	BODY_SITE	SPECIFIC_LOCATION	ELEVATION	COLLECTION_DATE	GENDER	ALTITUDE	NUCL_ACID_AMP	PCR_COND	SEX	CARB_NITRO_RATIO	ANNUAL_SEASON_TEMP	BACTERIALCELLSPERM3	PRINCIPAL_INVESTIGATOR_CONTACT	HOST_SUBJECT_ID	ANONYMIZED_NAME	POOL_PROPORTION	SAMP_SIZE	FLOOR	URL	STUDY_DESCRIPTION	CMIN_RATE	VENTILATION_TYPE	LONGITUDE	MIENS_COMPLIANT	TOT_ORG_NITRO	STUDY_CENTER	NUCL_ACID_EXT	BODY_HABITAT	BODY_PRODUCT	STUDY_ABSTRACT	ENV_FEATURE	KEY_SEQ	STUDY_TITLE	BARCODE_READ_GROUP_TAG	REGION	EXPERIMENT_DESIGN_DESCRIPTION	PCR_PRIMERS	PMID	AGE_IN_YEARS	HOST_INDIVIDUAL	ORIGINAL_SAMPLE_SITE	LAB_PERSON	EXPERIMENT_CENTER	COUNTRY	TEXTURE	EXPERIMENT_ALIAS	DEPTH	TREATMENT	HOST_TAXID	SILT_CLAY	TEMP_UNITS	SUBMIT_TO_INSDC	NICU	PRINCIPAL_INVESTIGATOR	PROJECT_NAME	SEQUENCING_METH	ROOM	TEMP	SOIL_MOISTURE_DEFICIT	COMMON_NAME	LEVEL	ENV_BIOME	PLATFORM	RUN_ALIAS	AIRFLOWVELOCITYMPERSEC	ANNUAL_SEASON_PRECPT	PH	POOL_MEMBER_ACCESSION	STUDY_ALIAS	EXPERIMENT_TITLE	TAXON_ID	SAMPLE_CENTER	SOIL_TYPE	AGE_UNIT	AIRCHANGESPERHOUR	STUDY_ID	LIBRARY_CONSTRUCTION_PROTOCOL	STUDY_REF	LOCAL_TIME	PUBLIC	HOST_COMMON_NAME	POOL_MEMBER_NAME	ENV_MATTER	TARGET_GENE	BUILDING	VENTILATION_METHOD	TARGET_SUBFRAGMENT	RUN_CENTER	PRIMER_READ_GROUP_TAG	SURFACE	HUMIDITY	INSTRUMENT_NAME	HUMIDITY_UNITS	LATITUDE	TIME_ZONE	HOSPITAL	Description
M1.489861	AACCAAGG	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	1420000	jlgreen@uoregon.edu	NA	M1	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	AC	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Mechanical	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	229	20.88706739	NA	air metagenome	NA	ENVO:city	FASTA	NA	9.016393443	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	5.358265096	1345	"FLX Titanium 27F, 338R"	NA	1130	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Mechanical	V2	Engencore	NA	NA	33.32786885	NA	percent	45.52	PST	NA	"mechanically ventilated hospital room, 11:30"
M2.489854	CCAAGGAA	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	937000	jlgreen@uoregon.edu	NA	M2	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	AC	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Mechanical	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	229	21.29690346	NA	air metagenome	NA	ENVO:city	FASTA	NA	8.655737705	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	3.529165064	1345	"FLX Titanium 27F, 338R"	NA	1300	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Mechanical	V2	Engencore	NA	NA	32.86229508	NA	percent	45.52	PST	NA	"mechanically ventilated hospital room, 13:00"
M3.489857	GAAGACCA	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	607000	jlgreen@uoregon.edu	NA	M3	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	AC	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Mechanical	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	231	22.25434028	NA	air metagenome	NA	ENVO:city	FASTA	NA	16.140625	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	8.406254985	1345	"FLX Titanium 27F, 338R"	NA	1600	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Mechanical	V2	Engencore	NA	NA	31.6703125	NA	percent	45.52	PST	NA	"mechanically ventilated hospital room, 16:00"
M4.489862	GCTTGCTT	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	1200000	jlgreen@uoregon.edu	NA	M4	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	AC	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Mechanical	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	231	21.91093474	NA	air metagenome	NA	ENVO:city	FASTA	NA	20.77777778	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	8.512498341	1345	"FLX Titanium 27F, 338R"	NA	1700	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Mechanical	V2	Engencore	NA	NA	32.65555556	NA	percent	45.52	PST	NA	"mechanically ventilated hospital room, 17:00"
M5.489864	TCCTCTTC	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/28/12 12:20	NA	0	NA	NA	NA	NA	NA	2580000	jlgreen@uoregon.edu	NA	M5	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	AC	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Mechanical	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	235	22.98148148	NA	air metagenome	NA	ENVO:city	FASTA	NA	4.484848485	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	5.102859082	1345	"FLX Titanium 27F, 338R"	NA	1220	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Mechanical	V2	Engencore	NA	NA	32.82575758	NA	percent	45.52	PST	NA	"mechanically ventilated hospital room, 12:20, 2/28/2012"
W1.489853	AACCAACC	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	723000	jlgreen@uoregon.edu	NA	W1	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	window	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Window	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	235	20.26451078	NA	air metagenome	NA	ENVO:city	FASTA	NA	21.05970149	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	11.71536064	1345	"FLX Titanium 27F, 338R"	NA	1130	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Window	V2	Engencore	NA	NA	34.76567164	NA	percent	45.52	PST	NA	"window ventilated hospital room, 11:30"
W3.489863	GAACACCT	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	867000	jlgreen@uoregon.edu	NA	W3	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	window	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Window	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	229	23.18189964	NA	air metagenome	NA	ENVO:city	FASTA	NA	8.290322581	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	13.68490584	1345	"FLX Titanium 27F, 338R"	NA	1600	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Window	V2	Engencore	NA	NA	30.2516129	NA	percent	45.52	PST	NA	"window ventilated hospital room, 16:00"
W4.489865	GGCCTAAT	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	625000	jlgreen@uoregon.edu	NA	W4	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	window	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Window	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	229	20.75308642	NA	air metagenome	NA	ENVO:city	FASTA	NA	8.80952381	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	12.05542727	1345	"FLX Titanium 27F, 338R"	NA	1700	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Window	V2	Engencore	NA	NA	34.96507937	NA	percent	45.52	PST	NA	"window ventilated hospital room, 17:00"
W5.489859	GTTGCTTC	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Indoor air	Indoor_air	NA	NA	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Indoor	NA	NA	NA	0	NA	NA	9.94	2/28/12 12:20	NA	0	NA	NA	NA	NA	NA	969000	jlgreen@uoregon.edu	NA	W5	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	window	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Window	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	231	21.61025641	NA	air metagenome	NA	ENVO:city	FASTA	NA	12.16923077	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	8.275441425	1345	"FLX Titanium 27F, 338R"	NA	1220	y	NA	NA	ENVO:air	16S rRNA	NA	Indoor Window	V2	Engencore	NA	NA	37.35230769	NA	percent	45.52	PST	NA	"window ventilated hospital room, 12:20, 2/28/2012"
O1.489860	CAACACCA	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Outdoor air	Outdoor_air	Outdoor Air	source	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Outdoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	572000	jlgreen@uoregon.edu	NA	O1	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	"none, outside air"	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Outdoor	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	Roof	11.77777778	NA	air metagenome	NA	ENVO:city	FASTA	NA	316.8	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	NA	1345	"FLX Titanium 27F, 338R"	NA	1130	y	NA	NA	ENVO:air	16S rRNA	NA	Outdoor	V2	Engencore	NA	NA	66.2	NA	percent	45.52	PST	NA	"outside air inlet, 11:30"
O2.489858	CCTTCCTT	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Outdoor air	Outdoor_air	Outdoor Air	source	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Outdoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	607000	jlgreen@uoregon.edu	NA	O2	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	"none, outside air"	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Outdoor	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	Roof	12.40740741	NA	air metagenome	NA	ENVO:city	FASTA	NA	322.6666667	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	NA	1345	"FLX Titanium 27F, 338R"	NA	1300	y	NA	NA	ENVO:air	16S rRNA	NA	Outdoor	V2	Engencore	NA	NA	62.66666667	NA	percent	45.52	PST	NA	"outside air inlet, 13:00"
O3.489856	GGAACCAA	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Outdoor air	Outdoor_air	Outdoor Air	source	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Outdoor	NA	NA	NA	0	NA	NA	9.94	2/27/12	NA	0	NA	NA	NA	NA	NA	502000	jlgreen@uoregon.edu	NA	O3	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	"none, outside air"	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Outdoor	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	Roof	13.33333333	NA	air metagenome	NA	ENVO:city	FASTA	NA	176	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	NA	1345	"FLX Titanium 27F, 338R"	NA	1600	y	NA	NA	ENVO:air	16S rRNA	NA	Outdoor	V2	Engencore	NA	NA	62.4	NA	percent	45.52	PST	NA	outside air inlet 16:00
O5.489855	TTCCAAGG	CAAGAGTTTGATCCTGGCTCAG	skembel@uoregon.edu	NA	Outdoor air	Outdoor_air	Outdoor Air	source	NA	n	2012	Architectural design influences the diversity and structure of the built environment microbiome	NA	hospital_air_seqs	NA	mimarks-survey	Outdoor	NA	NA	NA	0	NA	NA	9.94	2/28/12 12:20	NA	0	NA	NA	NA	NA	NA	2050000	jlgreen@uoregon.edu	NA	O5	NA	".1,g"	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome???the community of microorganisms that live indoors???is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	NA	"none, outside air"	-122.68	y	NA	U Oregon	NA	NA	NA	"Buildings are complex ecosystems that house trillions of microorganisms interacting with each other, with humans and with their environment. Understanding the ecological and evolutionary processes that determine the diversity and composition of the built environment microbiome the community of microorganisms that live indoors is important for understanding the relationship between building design, biodiversity and human health. In this study, we used high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility. We quantified airborne bacterial community structure and environmental conditions in patient rooms exposed to mechanical or window ventilation and in outdoor air. The phylogenetic diversity of airborne bacterial communities was lower indoors than outdoors, and mechanically ventilated rooms contained less diverse microbial communities than did window-ventilated rooms. Bacterial communities in indoor environments contained many taxa that are absent or rare outdoors, including taxa closely related to potential human pathogens. Building attributes, specifically the source of ventilation air, airflow rates, relative humidity and temperature, were correlated with the diversity and composition of indoor bacterial communities. The relative abundance of bacteria closely related to human pathogens was higher indoors than outdoors, and higher in rooms with lower airflow rates and lower relative humidity. The observed relationship between building design and airborne bacterial diversity suggests that we can manage indoor environments, altering through building design and operation the community of microbial species that potentially colonize the human microbiome during our time indoors."	ENVO:building	TCAG	Architectural design influences the diversity and structure of the built environment microbiome	NA	NA	high-throughput sequencing of the bacterial 16S rRNA gene to quantify relationships between building attributes and airborne bacterial communities at a health-care facility.	FWD:AGAGTTTGATCCTGGCTCAG; REV:TGCTGCCTCCCGTAGGAGT	PMID:22278670	NA	NA	NA	Steven Kembel/Gail Ackermann	U Oregon	GAZ:United States of America	NA	NA	0	Outdoor	NA	NA	C	n	NA	Jessica Green	Green_hospital_air	pyrosequencing	Roof	11.11111111	NA	air metagenome	NA	ENVO:city	FASTA	NA	0	NA	NA	NA	green_hospital_air_sloan	Architectural design influences the diversity and structure of the built environment microbiome	655179	U Oregon	NA	NA	NA	1345	"FLX Titanium 27F, 338R"	NA	1220	y	NA	NA	ENVO:air	16S rRNA	NA	Outdoor	V2	Engencore	NA	NA	78.2	NA	percent	45.52	PST	NA	"outsie air inlet, 12:20 2/28/2012"
F13Knee.140670	GACTGTCATGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample001	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F13Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F13Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F14Knee.140634	GAGTATGCAGCC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample002	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F14Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F14Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F23Knee.140816	GCCACTGATAGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	31	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample003	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F23Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F23Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F24Knee.140744	GCTAGTCTGAAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	31	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample004	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F24Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F24Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F33Knee.140702	GTATGCGCTGTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample005	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F33Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F33Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F34Knee.140341	GTCTATCGGAGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample006	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F34Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F34Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M13Knee.140288	GAACATGATGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	36	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample007	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M13Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M13Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M14Knee.140681	GACCGAGCTATG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	36	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample008	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M14Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M14Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M23Knee.140621	GATCTATCCGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	36	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample009	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M23Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M23Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M24Knee.140796	GCACTGAGACGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	36	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample010	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M24Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M24Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M33Knee.140298	GCTTGCGAGACA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample011	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M33Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M33Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M34Knee.140362	GTACGGCATACG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	33	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample012	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M34Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M34Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M43Knee.140412	GTGGCGATACAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	31	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample013	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M43Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M43Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M44Knee.140736	TAAGCGCAGCAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	31	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample014	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M44Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M44Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M53Knee.140318	TACTACATGGTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	60	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M5	sample015	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M53Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	60	M5	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M53Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M54Knee.140481	TAGCGACATCTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	60	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M5	sample016	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M54Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	60	M5	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M54Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M63Knee.140419	TATCTCGAACTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	NA	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M6	sample017	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M63Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	NA	M6	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M63Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M64Knee.140570	TCAGACAGACCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	back_of_knees	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	back of knees	FKB0RMH	NA	mimarks-survey	NA	FMA:Popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M6	sample018	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M64Knee	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	NA	M6	popliteal fossae	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M64Knee	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Nose.140325	AGCAGCACTTGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample019	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Nose.140365	AGTGTTCGATCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample020	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Nose.140573	ATGACTCATTCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	31	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample021	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Nose.140758	CACGGACTATAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	31	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample022	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Nose.140465	GCAGCACGTTGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample023	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Nose.140543	GCTGATGAGCTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample024	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Nose.140428	ACAGTGCTTCAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	36	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample025	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Nose.140763	ACTACGTGTGGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	36	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample026	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Nose.140682	CATATCGCAGTT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	36	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample027	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M22Nose.140594	CGAGTTGTAGCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	36	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample028	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M22Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M22Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Nose.140415	CGTGATCTCTCC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample029	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M32Nose.140531	CTCGATTAGATC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFLHOYS	33	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample030	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M41Nose.140779	GAATGATGAGTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	31	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample031	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Nose.140308	GAGCTGGCTGAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	external_nose	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	external nose	FFO92CG	31	mimarks-survey	NA	FMA:External nose	NA	NA	0	UBERON:nose	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample032	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Nose	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	external nose	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Nose	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Frhd.140508	AGAGTCCTGAGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample033	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Frhd.140469	AGTCTACTCTGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample034	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F13Frhd.140649	GACTGATCATCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample035	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F13Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F13Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F14Frhd.140741	GAGGCTCATCAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample036	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F14Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F14Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Frhd.140623	ATCGTACAACTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample037	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Frhd.140836	CAAGTGAGAGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample038	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F23Frhd.140622	GCATGTGCATGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample039	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F23Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F23Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F24Frhd.140858	GCTAAGAGAGTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample040	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F24Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F24Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Frhd.140832	GATGTGAGCGCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample041	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Frhd.140444	GCTAAGAGAGTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample042	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F33Frhd.140757	GTATCCATGCGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample043	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F33Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F33Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F34Frhd.140568	GTCGTGTGTCAA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample044	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F34Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F34Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Frhd.140548	ACACGGTGTCTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample045	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Frhd.140766	ACGGTGAGTGTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample046	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M13Frhd.140349	CTTGATGCGTAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample047	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M13Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M13Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M14Frhd.140825	GACATCGGCTAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample048	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M14Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M14Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Frhd.140641	CAGTGATCCTAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample049	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M22Frhd.140287	CGACAGCTGACA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample050	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M22Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M22Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M23Frhd.140404	GATCGCAGGTGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample051	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M23Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M23Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M24Frhd.140442	GCACGACAACAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	36	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample052	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M24Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M24Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Frhd.140336	CGTATCTGCGAA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample053	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M32Frhd.140776	CTATGCTTGATG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFLHOYS	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample054	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M33Frhd.140580	GCTTACATCGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample055	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M33Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M33Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M34Frhd.140638	GGTGCGTGTATG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	33	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample056	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M34Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M34Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M41Frhd.140449	CTTGATGCGTAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample057	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Frhd.140770	GAGAATACGTGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FFO92CG	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample058	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M43Frhd.140486	GTGCAATCGACG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample059	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M43Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M43Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M44Frhd.140730	TAACAGTCGCTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	31	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample060	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M44Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M44Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M53Frhd.140768	TACGTGTACGTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	60	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M5	sample061	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M53Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	60	M5	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M53Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M54Frhd.140695	TAGCATCGTGGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	60	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M5	sample062	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M54Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	60	M5	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M54Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M63Frhd.140286	TATCAGGTGTGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	NA	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M6	sample063	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M63Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	NA	M6	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M63Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M64Frhd.140834	TCACTGGCAGTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	forehead	Human Skin	source	NA	n	11/14/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	forehead	FKB0RMH	NA	mimarks-survey	NA	FMA:Forehead	NA	NA	0	UBERON:zone of skin of head	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M6	sample064	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M64Frhd	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	NA	M6	forehead	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FKB0RMH	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M64Frhd	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Glns.140664	ACACTAGATCCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFLHOYS	36	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample065	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Glns.140683	ACGTACTCAGTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFLHOYS	36	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample066	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Glns.140311	CAGTGCATATGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFO92CG	36	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample067	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M22Glns.140314	CGACATGCTATT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFO92CG	36	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample068	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M22Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M22Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Glns.140477	CGTATGCTGTAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFLHOYS	33	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample069	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M32Glns.140441	CTCAATGACTCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFLHOYS	33	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample070	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Glns.140719	GAGACAGCTTGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	glans_penis	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	glans penis	FFO92CG	31	mimarks-survey	NA	FMA:Glans penis	NA	NA	0	UBERON:glans penis	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample072	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Glns	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	glans penis	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Glns	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Hair.140612	AGATACACGCGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample073	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F12Hair.140386	AGTCTCGCATAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample074	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F21Hair.140524	ATCTACTACACG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	31	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample075	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F22Hair.140512	CACACGTGAGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	31	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample076	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F31Hair.140753	GATTAGCACTCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample077	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F32Hair.140769	GCTAGATGCCAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample078	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M11Hair.140577	ACACTGTTCATG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	36	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample079	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M12Hair.140590	ACGTCTGTAGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	36	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample080	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M21Hair.140504	CAGTGTCAGGAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	36	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample081	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M22Hair.140456	CGACTTATGTGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	36	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample082	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M22Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M22Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M31Hair.140713	CGTCAACGATGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample083	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M32Hair.140734	CTCAGTATGCAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFLHOYS	33	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample084	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M41Hair.140413	GAACATGATGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	31	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample085	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
M42Hair.140700	GAGAGAATGATC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	hair_on_head	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	hair on head	FFO92CG	31	mimarks-survey	NA	FMA:Head hair	NA	NA	0	UBERON:hair	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample086	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:hair	UBERON:hair	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Hair	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	hair on head	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human hair metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	646099	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Hair	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human hair metagenome
F11Labi.140687	AGATGTTCTGCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFLHOYS	33	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample087	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Labi.140407	AGTTAGTGCGTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFLHOYS	33	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample088	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Labi.140606	ATCTGGTGCTAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFLHOYS	31	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample089	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Labi.140560	CACATCTAACAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFLHOYS	31	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample090	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Labi.140819	GCACGACAACAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFO92CG	33	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample091	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Labi.140727	GCTATTCGACAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	labia_minora	Human Vagina	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	labia minora	FFO92CG	33	mimarks-survey	NA	FMA:Frenulum of labia minora	NA	NA	0	UBERON:labia minora	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample092	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:mucus	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Labi	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	labia minora	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Labi	ENVO:mucus	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Aptl.140780	ACTGTCGAAGCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample093	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Aptl.140591	AGCTGACTAGTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample094	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Aptl.140686	ATATCGCTACTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	31	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample095	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Aptl.140370	ATGTACGGCGAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	31	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample096	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Aptl.140409	GATCAGAAGATG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFO92CG	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample097	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Aptl.140820	GCCACTGATAGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFO92CG	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample098	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Aptl.140830	AACGCACGCTAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	36	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample099	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Aptl.140844	ACCTGTCTCTCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	36	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample100	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Aptl.140554	CAGATACACTTC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFO92CG	36	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample101	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Aptl.140756	CGCGATAGCAGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample103	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M32Aptl.140296	CTACTACAGGTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFLHOYS	33	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample104	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M41Aptl.140841	CTGCTGCGAAGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFO92CG	31	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample105	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Aptl.140537	GACGCTAGTTCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_armpit	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left armpit	FFO92CG	31	mimarks-survey	NA	FMA:Left axilla	NA	NA	0	UBERON:skin of arm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample106	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Aptl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left axilla	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Aptl	ENVO:sweat	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Knel.140331	ACTTGTAGCAGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	33	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample107	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Knel.140738	AGGACGCACTGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	33	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample108	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Knel.140372	ATCACGTAGCGG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	31	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample109	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Knel.140720	ATGTGCACGACT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	31	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample110	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Knel.140379	GATCGCAGGTGT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFO92CG	33	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample111	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Knel.140324	GCCTATACTACA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFO92CG	33	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample112	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Knel.140676	AACTGTGCGTAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	36	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample113	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Knel.140275	ACGAGTGCTATC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	36	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample114	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Knel.140490	CAGCACTAAGCG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFO92CG	36	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample115	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Knel.140873	CGCTAGAACGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFLHOYS	33	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample117	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M41Knel.140855	CTGGAGCATGAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFO92CG	31	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample119	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Knel.140699	GACTAACGTCAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_back_of_knees	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left back of knees	FFO92CG	31	mimarks-survey	NA	FMA:Left popliteal fossa	NA	NA	0	UBERON:zone of skin of knee	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample120	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Knel	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left popliteal fossa	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Knel	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Forl.140437	AGAGCAAGAGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	33	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample121	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Forl.140295	ATCGCGGACGAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	31	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample123	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Forl.140279	CAACTCATCGTA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	31	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample124	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Forl.140333	GATGCATGACGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	33	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample125	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F31Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F32Forl.140724	GCGTATCTTGAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	33	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample126	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F32Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F3	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F32Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M11Forl.140337	ACACATGTCTAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	36	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample127	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M11Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M11Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M12Forl.140812	ACGCTCATGGAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	36	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M1	sample128	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M12Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M1	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M12Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M21Forl.140771	CAGTCACTAACG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	36	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample129	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M21Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M21Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M22Forl.140587	CGAAGACTGCTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	36	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M2	sample130	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M22Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	36	M2	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M22Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M31Forl.140292	CGTACTAGACTG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	33	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample131	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M31Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M31Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M32Forl.140592	CTATCAGTGTAC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFLHOYS	33	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M3	sample132	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M32Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	M3	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M32Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M41Forl.140496	CTGTTCGTAGAG	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	31	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample133	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M41Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M41Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
M42Forl.140600	GACTGTCATGCA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_forearm	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left forearm	FFO92CG	31	mimarks-survey	NA	FMA:Surface of left arm	NA	NA	0	UBERON:skin of forearm	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	male	NA	NA	NA	NA	449:M4	sample134	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	M42Forl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	M4	left volar forearm	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFO92CG	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	M42Forl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F11Indl.140283	AGATCGGCTCGA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_index_finger	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left index finger	FFLHOYS	33	mimarks-survey	NA	FMA:Left index finger	NA	NA	0	UBERON:skin of finger	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample135	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F11Indl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left palmar index finger	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F11Indl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F12Indl.140710	AGTGAGAGAAGC	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_index_finger	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left index finger	FFLHOYS	33	mimarks-survey	NA	FMA:Left index finger	NA	NA	0	UBERON:skin of finger	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F1	sample136	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F12Indl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	33	F1	left palmar index finger	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F12Indl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F21Indl.140446	ATCTCTGGCATA	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_index_finger	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left index finger	FFLHOYS	31	mimarks-survey	NA	FMA:Left index finger	NA	NA	0	UBERON:skin of finger	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample137	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F21Indl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left palmar index finger	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F21Indl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F22Indl.140644	CACAGCTCGAAT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_index_finger	Human Skin	source	NA	n	8/18/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left index finger	FFLHOYS	31	mimarks-survey	NA	FMA:Left index finger	NA	NA	0	UBERON:skin of finger	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F2	sample138	0.005	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F22Indl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0708.12). On the day of sampling, participants were instructed to bathe in the morning using their choice of personal hygiene products, but to avoid wearing deodorant or antiperspirant. The interval between subject bathing and the collection of most samples likely ranged from around several hours to half an hour. Participants were asked to avoid eating or drinking for one hour prior to oral sampling. Skin surfaces, hair on top of the head, and nostrils (nares) were sampled using autoclaved cotton-tipped swabs (Puritan) pre-moistened with a sterile solution of 0.15 M NaCl and 0.1% Tween 20 (S1, S2). Swabbing has been shown to be a suitable method for skin sample collection for microbial community analysis (S3). Dry cotton-tipped swabs were used to sample the external auditory canal [and earwax (cerumen) if present], the dorsal surface of the tongue, and stool. Stool samples have been shown to provide an adequately representative sample of the gut microbiota (S4). Stool was swabbed using two different methods for comparison: i) off of used bathroom tissue and ii) by stabbing the swab directly into the largest piece of feces (see Fig. S22 for comparison). We found that swabbing off of used bathroom tissue was adequate for obtaining material for microbial community analysis. Swabs were placed in sterile 15 ml plastic tubes and stored at -80C within 10 minutes of sampling. Volunteers sampled stool on the same days that the other samples were collected (within 24 hours). If needed, the subjects were provided dry ice for the transport of their stool samples back to the lab. Liquid samples were also collected. The oral cavity was rinsed by swishing 10 ml of sterile water for 10 seconds, and then spitting the water into a sterile 50 ml plastic tube (see Fig. S22 for comparison to dorsal tongue swabs). Liquids were stored at 4C for several hours before sterile filtration onto 0.2micro-m pore size cellulose-nitrate filters (Nalgene). Filtered samples were immediately placed at -80C. Volunteers sampled themselves while wearing sterile gloves after first having their palms and index fingers swabbed by another person wearing sterile gloves. Replicate samples from the right and left sides of the body were taken when possible. All but one subject had not taken antibiotics in the 6 months prior to the June sampling dates, and none took antibiotics during the study period. Figure S1 lists the sample types, dates, and subjects. Samples were stored at -80C for <1 week prior to DNA extraction. We performed a follow-up study aimed at addressing whether skin location influences bacterial community assembly. Our approach involved transplanting foreign bacteria from various donor sites (dorsal tongue, forehead, and volar forearm) onto disinfected recipient skin sites (forehead and volar forearm) both within and between individuals. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (protocol 0109.23)."	FWD:GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG;REV:TGCTGCCTCCCGTAGGAGT	19892944	31	F2	left palmar index finger	Elizabeth Costello	CCME	GAZ:United States of America	NA	CostelloWholeBodySites	0	NA	9606	NA	NA	n	NA	NA	Costello_whole_body_sites	pyrosequencing	NA	NA	NA	human skin metagenome	NA	ENVO:human-associated habitat	FLX	FFLHOYS	NA	NA	NA	NA	CostelloWholeBodySites	Bacterial Community Variation in Human Body Habitats Across Space and Time	539655	CCME	NA	years	NA	449	"Amplicon DNA concentrations were determined using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen). Assays were carried out using 5-10 _l of cleaned PCR product in a total reaction volume of 200 _l in black, 96-well microtiter plates. Fluorescence was measured on a BioTek Synergy HT plate reader using the 480/520-nm excitation/emission filter pair. Following quantitation, cleaned amplicons were combined in equimolar ratios into a single tube. The final pool of DNA was precipitated on ice for 45 minutes following theaddition of 5 M NaCl (0.2 M final concentration) and 2 volumes of ice-cold 100% ethanol. The precipitated DNA was centrifuged at 7,800 x g for 40 minutes at 4C, and the resulting pellet was washed with an equal volume of ice-cold 70% ethanol and centrifuged again at 7,800 x g for 20 minutes at 4C. The supernatant was removed and the pellet was air dried for 10 minutes at room temperature and then resuspended in 100 micro-l of nuclease-free water (MO BIO). The final concentration of the pooled DNA was determined using a NanoDrop spectrophotometer (Thermo Fisher). Pyrosequencing was carried out using primer A on a 454 Life Sciences Genome Sequencer FLX instrument (Roche)."	costello_whole_body_sites	NA	y	human	F22Indl	ENVO:sebum	16S rRNA	NA	NA	V2	CGS-GL	V2	NA	NA	NULL	NA	40.0149856	NA	NA	human skin metagenome
F31Indl.140679	GCAATAGCTGCT	CATGCTGCCTCCCGTAGGAGT	costelle@stanford.edu	swab with sterile saline	NA	left_index_finger	Human Skin	source	NA	n	8/20/08	Bacterial Community Variation in Human Body Habitats Across Space and Time	left index finger	FFO92CG	33	mimarks-survey	NA	FMA:Left index finger	NA	NA	0	UBERON:skin of finger	NA	1624.097656	2008-2009	NA	0	PMID: 19892944	initial denaturation: 94; annealing: 50_0.5; elongation: 72_1.5; final elongation: 72_10; 35	female	NA	NA	NA	NA	449:F3	sample139	0.006	"1, swab"	NA	http://www.scienceonline.org/cgi/content/abstract/1177486	Sampling of multiple human body sites	NA	NA	-105.2705456	y	NA	CCME	http://www.mobio.com/soil-dna-isolation/powersoil-dna-isolation-kit.html	UBERON:skin	UBERON:sebum	"Elucidating the biogeography of bacterial communities on the human body is critical for establishing healthy baselines from which to detect differences associated with diseases. To obtain an integrated view of the spatial and temporal distribution of the human microbiota, we surveyed bacteria from up to 27 sites in seven to nine healthy adults on four occasions. We found that community composition was determined primarily by body habitat. Within habitats, interpersonal variability was high, whereas individuals exhibited minimal temporal variability. Several skin locations harbored more diverse communities than the gut and mouth, and skin locations differed in their community assembly patterns. These results indicate that our microbiota, although personalized, varies systematically across body habitats and time; such trends may ultimately reveal how microbiome changes cause or prevent disease."	ENVO:human-associated habitat	TCAG	Bacterial community variation in human body habitats across space and time	F31Indl	0	"Healthy adults were recruited to donate samples on two consecutive days in June and again three months later on two consecutive days in September 2008. Volunteers were unrelated individuals of both sexes and most lived in Boulder, CO. Female subjects F1, F2, F3 and male subjects M1, M2, M3, M4, and M6 were 30-35 years old. Subject M5 was approximately 60 years old. The health status of the volunteers was self-reported. None of the volunteers indicated that they had been hospitalized in the previous 6 months. All individuals were made aware of the nature of the experiment and gave written informed consent in accordance with the sampling protocol approved by the University of Colorado Human Research Committee (proto