Methicillin-resistant S. aureus USA300-0114 and 5 clinical combat wound isolates of P. aeruginosa (obtained from the U.S. Army Institute of Surgical Research, Fort Sam Houston, TX) were used. Tryptic soy broth (TSB) served as the growth medium, while Oxoid's Oxacillin Resistance Screening Agar Base (ORSAB) and Pseudomonas Agar with CN supplement (Oxoid) were used as selective media for plate-counting.

In order to quantify biofilm production by P. aeruginosa wound isolates, 10⁶ bacteria were inoculated in TSB media in 12-well polystyrene plates and incubated at 37°C for 24 h. Biofilm biomass by adherent bacteria was quantified upon removal of medium, washing with phosphate-buffered saline (PBS), and staining with 0.2% crystal violet [45]. Biofilm bound dye was recovered with 100 µl of 1% sodium dodecyl sulfate (SDS), and each biomass was quantified by measuring absorbance at 590 nm (A₅₉₀). Wells incubated without bacteria were used as blanks. Alternatively, P. aeruginosa 09-010, USA300, or a combination of both species was grown in TSB under same conditions. In order to quantify the number of viable cells grown in the biofilm, bacteria were recovered with sonication at 50W for 10 sec to separate bacterial cells attached to the wells, and serial dilutions were plated on selective medium, ORSAB or Pseudomonas Agar with CN supplement, to determine colony forming units (CFU).

Two young, female, specific pathogen-free pigs (SPF: Ken-O-Kaw Farms, Windsor, IL) weighing between 25 and 35 kg were used in this study. These animals were fed a non-antibiotic chow ad libitum before the study, fasted overnight before the procedures, and housed individually in our animal facilities (meeting USDA compliance) with controlled temperature (19–21°C) and controlled light and dark cycles (12 hour light/12 hour dark). The experimental animal protocols were approved by the University of Miami Institutional Animal Care and Use Committee and all the procedures followed the federal guidelines for the care and use of laboratory animals. In order to minimize possible discomfort, analgesics (buprenorphine and fentanyl transdermal patches) were used during the entire experiment. Forty eight (48) partial thickness wounds were made on the paravertebral area of each animal. The wounds were then divided into four groups, each containing 12 wounds. First group was inoculated with USA300, second group was inoculated with P. aeruginosa, third group was inoculated with both USA300 and P. aeruginosa simultaneously, and the fourth group remained un-infected as a control. Three wounds from each group were used to determine bacterial counts and bacterial RNA, and an additional three wounds were used for histological evaluation and host RNA isolation at days 2 and 4 post-wounding and inoculation from each animal.

Methods describing the animal preparation and wounding are explained in detail in our previous studies [43], [46]. Briefly, the flank and the back of experimental animals were prepped on the day of the experiment. Animals were anesthetized and partial thickness wounds (10 mm×7 mm) were made on the paravertebral area using a modified electrokeratome set at 0.5 mm deep [44]. The wounds were separated from one another by approximately 50 mm areas of unwounded skin.

Wounds were inoculated with 25 µl of 10⁶ CFU/mL of either USA300, P. aeruginosa, or both species immediately after wounding. In order to promote establishment of biofilm infection, wounds were covered with a polyurethane film dressing (Tegaderm; 3 M Health Care, St. Paul, MN) to allow for biofilm formation as previously described [43]. The film dressings were secured in place by wrapping the animals with self-adherent bandages (Petflex; Andover, Salisbury, MA).

Three wounds from each treatment group at each assessment time were cultured quantitatively using a modified scrub technique [43]. Each wound was encompassed by a sterile surgical grade steel cylinder (22 mm outside diameter) and bacteria were collected by scrubbing the wound area with a sterile Teflon spatula into 1 ml of sterile phosphate buffer saline. 500 µl of collected suspension was centrifuged and the remaining pellet was preserved in RNAlater (Ambion) for RNA extraction. The remaining portion of the recovery suspension (500 µl) was used for the quantification of viable organisms. Serial dilutions were made and plated using a Spiral Plate System (Rockland, MA), and selective media, ORSAB for USA300 and Pseudomonas Agar with CN supplement was used to determine CFUs in the scrub solution collected from each wound. Plated bacteria were incubated aerobically for 24 hours at 37°C. CFUs were determined by the standard colony counting method.

Three wounds per group were assessed on Days 2 or 4 post inoculation and wounding. A 4 mm punch biopsy was collected from the center of the wounds and stored in RNA later (Ambion) for further RNA isolation. Three additional punches were collected from unwounded skin and also preserved in RNA later. To evaluate wound healing rates, incisional biopsies from three wounds per condition from each animal were obtained; a transverse section approximately 3-mm thick was cut through the central part of the wound, including 5 mm of adjacent uninjured skin at day 2 and 4 post-wounding. The tissues were fixed and processed for paraffin embedding. 7 µm sections were cut and stained with hematoxylin and eosin. Staining was analyzed using a Nikon Eclipse E800 microscope, and the digital images were collected using SPOT camera advanced program. The wounds were quantified by planimetry as described previously [47], [48], [49].

Paraffin sections were used for staining with anti-K14 antibody (1∶50, Abcam). 5 µm thick sections were de-waxed in xylene, rehydrated, and washed with 1× phosphate-buffered saline (PBS) (Fisher Scientific). For antigen retrieval, sections were heated in 95°C water bath in target retrieval solution (DAKO Corporation). The tissue sections were blocked with 5% bovine serum albumin (Sigma) and incubated with antibody against K14 overnight at 4°C. The slides were then rinsed in PBS, incubated with Alexa Fluor 488-conjugated goat anti-mouse antibody (Invitrogen) for 1 hr at room temperature and mounted with Prolong DAPI Gold antifade reagent (Invitrogen) to visualize cell nuclei. Specimens were analyzed using a Nikon eclipse E800 microscope and digital images were collected using the NIS Elements program.

Porcine RNA was isolated using RNAspin Mini Kit (GE healthcare) following manufacturer’s instruction. Briefly, skin was digested with proteinase K treatment in TES buffer (30 mM Tris, 10 mM EDTA, 1% SDS, pH 8) and homogenized using a handheld homogenizer and disposable sterile pestle upon addition of RA1 lysis buffer. Bacterial RNA was isolated from both in vitro grown bacteria and collected wound scrub samples using RNeasy Mini Kit (Qiagen, Hilden, Germany). Bacterial pellets were digested and lysed in the presence of proteinase K containing either lysozyme (1 mg/ml; Sigma), or lysostaphin (Sigma, 30 U/ml) for samples collected from P. aeruginosa and USA300 wounds, respectively. Combination of lysozyme and lysostaphin was used for scrubs samples collected from mixed species inoculated wounds. RNA quality and concentration was assessed on the Agilent Bioanalyzer using the RNA 6000 Pico LabChip® Kit (Agilent Technologies, Waldbronn, Germany).

For real-time qPCR, 20 ng of total RNA from unwounded porcine skin and wound tissue was reverse transcribed and amplified using iScript One-Step RT-PCR Kit (Biorad). Real-time PCR was performed in triplicates using the IQ5 multi-color real-time PCR system (Bio-Rad). Relative expression was normalized for levels of GAPDH. The porcine primer sequences used were: GAPDH, forward (5′-ACATCATCCCTGCTTCTAC-3′) and reverse (5′-T TGCTTCACCACCTTCTTG-3′); IL-1α, forward (5′-GCCAATGACACAGAAGAAG-3′) and reverse (5′-TCCAGGTTATTTAGCACAGC -3′); IL-1β forward (5′-GGCTAACTACGGTGACAAC-3′) and reverse (5′- GATTCTTCATCGGCTTCTCC-3′); IL-6 forward (5′-TTCACCTCTCCGGACAAAAC-3′) and reverse (5′-TCTGCCAGTACCTCCTTGCT-3′); IL-8, forward (5′- GACCAGAGCCAGGAAGAGAC -3′) and reverse (5′-GGTGGAAAGGTGTGGAATGC-3′); IL-10 forward (5′-TGGAGGACTTTAAGGGTTAC-3′) and reverse (5′-CAGGGCAGAAATTGATGAC-3′); TNFα forward (5′-CACGCTCTTCTGCCTACTG-3′) and reverse (5′- ACGATGATCTGAGTCCTTGG -3′); KGF1 forward (5′-CAGTGACCTAGGAGCAACGA-3′) and reverse (5′-AAAGTGCCCACCAGACAGAT-3′).

For bacterial RNA, reverse transcription with DNase treatment was performed using QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturers’ protocol and amplified using IQ Supermix (Bio-Rad). Gene quantification was performed in triplicates using the IQ5 multi-color real-time PCR system (Bio-Rad). For each sample, a mock reaction without addition of reverse transcriptase was performed. The sequences of the primers are shown in Table 1 and 2. Relative expression was normalized for levels of gyrA for USA300 and rpoD for P. aeruginosa. GyrA-FAM set of primers was used in combination with hla-CY5 and spa-HEX. Primers and probe for pvl gene were designed as previously described [50]. P. aeruginosa and USA300 specific primers and TaqMan probes were designed with the Beacon Designer™ software (Premier Biosoft International). The specificity of all primers was confirmed by sequencing of PCR products.

Statistical comparisons of CFUs were performed using Student’s t-test and presented as means±standard deviation (SDs). Statistically significant differences were defined as p<0.05. A comparison of epithelialization rates and gene-expression data for each treatment group was performed using GraphPad Prism 4. The means were analyzed by an ANOVA, followed by the Bonferroni post-hoc test. Significance was defined as a p<0.05.

To determine the presence and expression of virulence factors and quorum sensing molecules in six P. aeruginosa combat wound isolates we used PCR. Results revealed differences in expression of genes encoding quorum sensing ligands and Pseudomonas virulence factors in the wound isolates. Genes encoding autoinducer synthesis protein RhlI (RhlI) and a key enzyme in alginate production, GDP-mannose 6-dehydrogenase (AlgD), were present in all strains tested. Only one of the strains tested, P. aeruginosa 09-010, had a gene encoding ExoS, while the isolates 09-007 and 09-008 did not contain ToxA nor autoinducer synthesis protein LasI (Fig. 1A). Identical results were obtained when RNA was used as a template (data not shown). Of five isolates tested, only one P. aeruginosa 09-010, had all genes expressed. In addition in vitro biofilm assay identified isolate 09-010 as the most potent biofilm producer (Fig. 1B) and therefore this isolate was selected for further mixed-species studies with USA300.

In order to assess the growth of USA300 and P. aerugionsa 09-010 in mixed-species biofilms, in vitro individual species and co-cultures were grown on polystyrene plates to allow for bacterial attachment and biofilm formation. USA300 and P. aerugionsa 09-010 CFUs were determined after removal of planktonic bacteria. In accordance to previous studies [51], [52] Pseudomonas had an inhibitory effect on S. aureus US300 growth, which was reduced by 4 logs in mixed-species biofilms in vitro (Fig. 2A).

To further determine the effects of mixed-species infection on the growth of individual species in vivo, bacteria were allowed 2 and 4 days post wounding to form a biofilm and CFUs were determined by plating scrubbed wound solution on selective media. Results show that USA300 and P. aeruginosa co-existed in the wounds; and that the growth of USA300 was slightly reduced by P. aeruginosa 09-010 in vivo, by 1.5 and 1.6 log on days 2 and 4 after wounding, respectively (Fig. 2B). The growth of Pseudomonas remained unchanged in the presence of USA300. Although with slightly reduced CFUs, both species remained present in wounds at day 4 post inoculation. There was no cross-contamination between the wounds as wounds inoculated with USA300 showed no detectable Pseudomonas, and no USA300 was recovered in P. aeruginosa 09-010 inoculated wounds. Neither Pseudomonas nor USA300 were detected in un-inoculated control wounds using selective growth media, and in addition, gram staining was used to document that control wounds remained non-infected. In summary, Pseudomonas has shown an inhibitory effect on USA300 growth in the mixed-species biofilms in vitro, while this effect was not as profound in vivo.

Wound healing rates in single and mixed-species infected wounds were assessed by histology. The rate of epithelialization was measured using planimetry [47], [49]. Wounds with polymicrobial infection showed a significant wound healing impairment over the wounds infected with single-species biofilms (Fig. 3A). Both USA300 and P. aeruginosa infected wounds showed delayed epithelialization when compared to control, uninfected wounds, however statistically significant differences were seen only in USA300 infected wounds (Fig. 3B). The average rate of epithelialization at day 2 for USA300, P. aeruginosa, and wounds infected with both species was 42%, 57%, and 35%, respectively, as compared to 74% wound closure in control uninfected wounds (Fig. 3A).

We further analyzed host response in an established porcine partial thickness wound healing model [19], [43], [46] using biopsies collected from the wound center after inoculation with P. aeruginosa, USA300 or a combination of both bacterial species. Significant suppression of KGF1 was found in wounds infected by mixed-species biofilms (Fig. 4A), while single species infection did not result in suppression of KGF1 expression. KGF1 is produced during acute wound healing process mainly by fibroblasts, and has been shown to stimulate proliferation and migration of keratinocytes thus playing an important role in re-epithelialization [53], [54]. Staining with epidermal marker, K14 specific antibody, confirmed delayed epithelialization in infected wounds when compared to non-infected control wounds (Fig. 4B), with more pronounced inhibition of wound closure in mixed-species infected wounds. In addition K14 staining revealed reduced epithelial thickness in infected versus non-infected, control wounds (Fig. 4B).

We also analyzed immune response at days 2 and 4 post-wounding to examine gene expression of pro- and anti-inflammatory cytokines [63] responding to single or mixed-species infection using qPCR. The most significant changes in cytokine expression were detected in wounds at day 2 post infection (Fig. 5). Significant induction was found in TNFα, IL-1α and IL-1β mRNA levels between infected and uninfected wounds, regardless of the bacterial species used for wound inoculation, suggesting that the presence of both USA300 and P. aeruginosa contributes to increased expression of these pro-inflammatory cytokines in cutaneous wounds. IL-8 expression was also induced in single and mixed-species infected wounds in comparison to uninfected wounds. Expression of IL-6 was induced in wounds infected with either mixed-species or Pseudomonas. IL-6 also showed an increasing trend in USA300 infected wounds; however these changes were not significant in comparison to control, non-inoculated wounds. The expression of IL-10, an anti-inflammatory cytokine, was significantly up-regulated in wounds infected with Pseudomonas, while USA300 or mixed-species infection did not cause significant induction of IL-10, although an increasing trend of IL-10 was observed in these wounds. We did not observe synergistic nor additive effects of polymicrobial infection on cytokine expression. In contrast, expression levels of IL-1α, IL-1β, IL-6 and IL-10 showed a decreasing trend in multi-species versus single-species infected wounds. These data show distinct differences in the host immune responses in porcine deep partial thickness wounds when stimulated with USA300, P. aeruginosa, or combination of both species. Although bacterial counts were still significantly high at day 4 post-wounding (Fig. 2) the expression of all tested cytokines was similar to expression levels detected in normal unwounded skin (data not shown). Even though infection inhibited early epithelialization, both uninfected and infected wounds epithelialized by day 4.

To measure relative expression levels of USA300 virulence factors, spa, hla and pvl, RT-PCR analysis with bacterial RNA isolated from mixed- and single-species infected wounds was performed. Expression levels of virulence factors in the wound environment were also compared to mRNA levels of spa, hla and pvl in vitro (Fig. 6).The wound environment led to a striking induction of spa expression, with mRNA levels of spa 30 times higher in wounds as compared to in vitro. Interestingly, the presence of P. aeruginosa led to suppression of this virulence factor in the mixed-species colonized wounds at days 2 and 4 post-inoculation. In contrast to observed suppression of spa, the presence of P. aeruginosa induced expression of USA300 virulence factor hla on day 4 post wounding and infection (Fig. 6). The expression of pvl, a major cause of skin necrosis [55], [56], [57], was induced 8-fold in USA300 colonized wounds at day 2 versus pvl expression levels in vitro, while reduced pvl levels were seen on day 4 post wounding. More importantly the presence of P. aeruginosa in mixed species infected wounds resulted in a striking induction of pvl at both assessment times (Fig. 6).