We used CdtB as a surrogate marker for the Cdt holoenzyme. CdtB can act alone in in vitro tests although it is not as potent as the holoenzyme containing CdtA, CdtB and CdtC, [23].

CdtB protein isolated from IDH781 was cloned into the protein expression vector PET100/DTOPO (Invitrogen). The primers were constructed according to the manufacturer’s recommendation with a CACC at the 5′ terminal end of the forward primer and stop codon added at the 3′ end of the reverse primer end. The cdtB gene was amplified by PCR using the following primers:

CdtBF 5′ CACCATGCAATGGGTAAAGCAATT (1351–1370 of the Sugai sequence AB011405.1 (Genbank Accession # AB01140405) and CdtBR2 5′TTAGCGATCATGAACAAAACTAAC (2202–2178 of the Sugai sequence [24]). The cloned cdtB gene was verified by sequence analysis using the cloning primers on the plasmid construct. Plasmid DNA of the correct plasmid construct was transformed into the E coli expression strain BL21 (Invitrogen). Induction of cdtB expression was performed by incubation with 0.1 mM IPTG after 4 hours of growth. Cells were pelleted and the pellet lysate was run on a (4–20%) pre-cast polyacryamide gel (Bio-Rad), which showed an induced band at approximately around 30 kDa. The gel was blotted and hybridized with anti-poly-His antibody linked to alkaline phosphatase (Sigma), which demonstrated that the cloned band and the induced band were the same. The strain was grown and the cell pellet was lysed under denaturing conditions and the CdtB polyhistidine fused protein was isolated using a Nickel column (Qiagen). The protein isolated was then dialyzed under stepwise dilutions, decreasing the urea concentration to zero, and increasing the pH to pH7.0 to allow the protein to refold. The final buffer condition was 100 mM NaH₂PO₄, 10 mM Tris-Cl, pH 7.0. The recombinant protein was tested against the rat lymphocytes.

In general we followed the rat model protocol we ran in previous studies [26], [27]. We conducted one study using the cdtB mutant strain and a second study using the ltxA mutant strain. Eighteen specific-pathogen-free male Sprague Dawley rats (5–10 week of age) were housed in separate cages and fed powdered food (Laboratory Rodent Meal Diet 5001, Purina Mills Feeds) to promote plaque development. The rats were given 20 mg/ml kanamycin and 20 mg/ml ampicillin in their drinking water for four days to depress the resident flora. During the final two days of antibiotic treatment, the rats’ mouths were also swabbed with chlorhexidine gluconate 0.12% rinse. Following a rinse-out period of three days the rats were divided into three groups of six rats per group for each study. In the first set of experiments, Group 1 was the control and received no bacteria. Group 2 received the cdtB mutant HS1031Rif. Group 3 received wild type Aa strain IDH781NRif. The bacteria inoculation was given three hours after fasting. The inoculum given to Group 2 or Group 3 consisted of 108 bacterial cells in 3% sucrose PBS mixed with a small amount of powdered food, put in special feeder trays, which fit over the bedding in the cage. The Aa strains were grown and inocula were prepared as previously described [27]. After an hour the inoculated food was removed and replaced with regular powdered food. This inoculation-feeding regimen was repeated for eight days. The rats were then fed powdered food for a month. The rats were then switched to pellet food to prevent overgrowth of the incisor teeth. In the second study, Group 1 was the control, Group 2 was fed the ltxA mutant strain Aa1700Rif and Group 3 received the wild type strain DF2200Rif.

Two weeks after bacterial inoculation, the rats’ oral flora was sampled with a cotton tip swab for soft tissue and a Stimudent (Johnson & Johnson) for hard tissue. Dilutions of the samples were plated on enriched trypticase soy agar (ETSA)+10%Sheep Blood at 37°C for three days for total counts and on AaGMRif35 plates at 37° with 10% CO₂ for three days to select for the introduced Aa.

Twelve weeks past the final bacterial feeding, the oral flora of the rats was again sampled. The rats were euthanized by intraperitoneal injection of sodium pentobarbital (100 mg/kg), at which time blood samples were taken by cardiac puncture to determine post-inoculation relative Aa antibody levels, and the upper jaws were removed for the assessment of bone loss.

The oral flora of the rats was sampled as described above and plated on ETSA +10% sheep blood for total bacterial counts and on AaGMRif35 plates to select for Aa. The colonies were counted on both types of plates and expressed as CFU (colony forming units) per ml of collected sample in PBS. For each oral sample, the CFU/ml for Aa plates was divided by the total bacteria CFU/ml for the sample to correct for variation in sampling. The means of the ratios of Aa/total CFU/ml were calculated for each rat treatment group and the means were compared by ANOVA analysis. The first and second studies were handled in identical manner.

Our methods for measuring bone loss and disease were previously described [26] and used in this study. Photos of the stained jaws and teeth were taken using a DP12 microscope digital camera system (Olympus) at a 9.2× magnification. The bone loss was measured in a blind manner in duplicate by an examiner. The vertical distance between the cemento enamel juction (CEJ) and the alveolar bone crest (ABC) was measured at 10 sites on the three maxillary molars on each sides of the jaw [26] [22].

The raw bone loss data for each group was decoded and sent to an independent statistician. The mean and standard deviation of total bone loss at each site was calculated for each of the treatment groups. A diseased site was defined as a site where the measurement of bone loss (defined as the distance between the cemento-enamel junction and the bone crest) was greater than two standard deviations above the mean of the bone loss measure for that site in the control group. If a rat had two or more diseased sites per jaw, the rat was considered a diseased rat. To compare the associations between groups and disease, the groups were compared using Fisher’s Exact Test and the Cochran Armitage Trend Test. The results were considered significant at a probability level of p<0.05. The results of the determination of diseased rats between the two reads were compared using a measure of agreement (kappa) score [26].

Relative Aa IgG antibody levels was determined by ELISA, as previously described [22]. Preinoculation tail bleeds were taken from two rats in each experimental group. Blood was also collected from all rats by cardiac puncture after their sacrifice at 12 weeks after inoculation. To identify the level of background reaction to the Aa, sera from preinoculated rats and sera from the control group of uninoculated rats were also tested for their reaction to Aa.

The cloning vector and the vector used for transformation into Aa was PVK50. This plasmid was constructed by first amplifying a region of Aa containing two copies of the Aa uptake sequence [28], using primers USS-F and USS-R which amplified a 210 bp region between sodA and and gene AA00069 in the HK1651genome (http:/www.oralgen.lanl.gov/coordinates 52,230–52,341). The template strain DNA was from HK1651. The primers were designed to add a HindIII site at one of the fragment and a KpnI site at the other. The 220 bp PCR product was digested with HindIII and KpnI and ligated into the HindIII/KpnI sites of LITMUS28 (New England Biolabs).

Portions of the cdtB and CdtC genes of Aa strain DF2200N were amplified by PCR (using primers CC4 5′AGGTTAAACACAGTATGA3′ bases 2569–2545 of sequence reported by Sugai (GenBank accession # AB01140405.1) [24] and CB6 5′ACAGTGCATGCTTGGCCA3′ bases 1822–1831 of Sugai’s sequence(GenBank accession # AB01140405.1) to generate a 747 bp band. For the PCR reaction, Ready-To-Go PCR beads (GE Healthcare) were used according to the manufacturer’s instructions. The PCR reaction product was purified by using a Qiaquick PCR purification kit (Qiagen).

The amplified fragment was then treated with DNA polymeraseI large fragment, Klenow Enzyme (Roche), to blunt the ends of the fragment. The vector pVK50 was digested with restriction enzyme EcoRV (Invitrogen) according to manufacturer’s instruction, to generate a blunt ended cut in the plasmid. The cut plasmid and the Aa PCR fragment was then ligated using T4 ligase (Roche). The ligation reaction (2 µl) was used to transform One ShotTOP10F’ E. coli competent cells (Invitrogen) and the resulting ampicillin resistant colonies were grown on LBamp50 plates. Clones with inserts were identified by agarose gel electrophoresis. The cloned 747 bp PCR fragment was verified by sequencing the insert using the CC4, CB6 primers. This plasmid was named HS65. The plasmid was mutagenized by Tn5 insertions in vitro using the EZ-Tn5<KAN-2> Insertion Kit following manufacturers’ instructions (Epicenter). When E. coli TOP10 was transformed with the mutated plasmid, colonies containing the transposons were resistant to kanamycin 50 µg per ml in agar plates. Transposon insertions in cdtB were identified by amplifying the cdtB gene using primers CB-1 (5′ ATGCAATGGGTAAAGCAATTA bases 1351–1372 of the Sugai sequence [24]) and CB-2 (5′TTAGCGATCATGAACAAAACTAAC bases 2202–2178 [24]). The location of the transposon was found by sequencing from the ends of the cloned fragment using primersCC4 and CB6. The transposon was inserted at base 2102 of the sequence reported by Sugai [24], in codon 252 of cdtB. Plasmid DNA from the clone containing the cdtB insertion was isolated using Qiaprep spin miniprep kit (Qiagen). This plasmid was named HS66. Aa strain IDH781Nal (pMB7) [29] was transformed with HS66 DNA using an inducible tfox system [29]. The position of the transposon in the bacterial strain was verified by sequencing, analysis using primers CC4 and CB6. The IDH781Nal Cdt B mutant was named HS1030. For use in the animal model we selected a rifampicin resistant mutant clone of HS1030 which was able to grow on AaGMRif35 plates. This IDH781NRif strain with the cdtB transposon mutation was called HS1031. Plasmids and strains are described in Table 1.

The ltxA mutant strain Aa1700 and its parental unmutated strain DF2200 were provided by Dr. Scott Kachlany (Department of Oral Biology NJ Dental School). The LtxA mutant’s construction was previously described [30] using the method developed by M.K. Bhattacharjee [29]. The general details of this method used was the same as that used for the CdtB mutant, except the transposon insertion was in the ltxA gene and the parental strain was DF2200. Rif resistant strains were selected by plating lawns of bacteria on Rif35 plates and selecting for Rif resistant colonies.

All analyses were done using JMP software (SAS). For analyses of the effect of toxins on lymphocytes the MFI of the test lymphocyte cultures were compared with control cultures (0 ng/ml CdtB or 0 ng/ml LtxA) using two-tailed Student’s t-test (p<0.05). Significance of Aa infection was assessed by comparing the total Aa CFU/total bacterial counts per group by ANOVA analysis. Aa-induced antibody production was determined by comparing serum antibody response in Aa-fed rats to that of control rats using ANOVA and Tukey’s post hoc test. Student’s t-test was used, where appropriate, to determine statistical significance (p<0.05). For determination of significance of bone loss the means of the total bone loss per group were compared by ANOVA analysis. Comparison of associations between groups and disease, were determined using Fisher’s Exact Test and Cochran Armitrage Trend test.

Colonization by the cdtB mutant strain was comparable to the wild-type strain (Table 2). The CFU of cdtB mutant strain devided by total CFU was a mean of 21.01±26×10⁻⁴ at 2 wks and 0.68±.09×10⁻⁴ at 12 weeks. The wild type strain group divided by total flora CFU was a mean of 16.36±15×10⁻⁴ at 2 weeks and 7.16±9.6×10⁻⁴ at 12 weeks. At both 2 and 12 weeks, the Aa/total count means were not significantly different between Group 2 (the cdtB mutant) and Group 3 (IDH781 wild type). The means of the Aa counts/total bacterial count per group dropped from the 2 week sampling to the 12 week sampling for both cdtB plus and cdtB minus groups.

Colonization by the wild-type and mutant strains of ltxA are described in Table 3. The ltxA mutant strain group divided by total flora CFU was a mean of 16.31±31.6×10⁻⁴ at 2 wks and 0.49±.072×10⁻⁴ at 12 weeks The wild type strain group divided total flora CFU was a mean of 33.61±81.0×10⁻⁴ at 2 weeks and 0.36±0.69×10⁻⁴ at 12 weeks. Colonization by the ltxA positive stain and the ltxA negative strain was not significantly different at 2 weeks and 12 weeks. Again, the means of the Aa counts/total bacterial counts dropped from 2 weeks to 12 weeks.

For Cdt (Table 2), the mean total bone loss seen in IDH781 (wild type strain) was significantly different from that of the negative control by ANOVA and Tukey’s studentized range post–hoc test. The cdtB mutant group, had more mean total bone loss than the negative control group and less than the wild type group; but the differences were not significant.

For LtxA (Table 3), using ANOVA and Tukey’s studentized range post–hoc test, the mean total bone loss of the wild-type group was significantly different from the mean of the control group and the mean of the ltxA mutant group. In all cases the wild type group showed more bone loss than the ltxA mutant group and the control group. All differences were significant (p<0.05).

For Cdt (Table 2), the results of Fischer’s Exact and Cochran Armitage Trend test showed that there was a significant difference in frequency of disease between wild type IDH781 treatment (5/6 diseased), and the control group (0/6 diseased) p<0.05) The highest level of disease was found in the wild type IDH781 group, while the lowest was found in the uninoculated control group. Again using Fischer’s exact test and the Cochran Armitage Trend test the cdtB mutant Group, had significantly more disease than the control group (mutant vs control = 3/6 diseased vs 0/6 diseased ) p<0.05, however the mutant strain was not significantly different from the wildltype group (mutant strain vs wildtype = 3/6 diseased vs 5/6 diseased). The mutant strain was significantly different from the control strain (mutant 3/6 diseased vs control strain 0/6 diseased.

For LtxA (Table 3), using Fisher’s exact test and Cochran Armitage Trend test there was a significant difference between the wild type group DF2200 (4/6 diseased) and the uninoculated control group (0/6 diseased). There was also a significant difference between the wildtype group (4/6 diseased) and the ltxA mutant group (1/6 diseased). The control group (0/6 diseased) was not significantly different from the ltxA mutant group (1/6 diseased). However, in this case the ltxA the mutant strain was significantly different from the wildtype strain (wildtype 4/6 diseased vs mutant 1/6 diseased).

Based on these results, the ltxA mutant strain has a greater effect on bone loss than does the cdtB mutant because it shows significantly less bone loss than the wildtype strain. While the cdtB mutant strain shows a trend in the direction of bone loss, the data does not achieve significance. Put another way, the disease caused by cdtB mutant strain, in which ltxA is expressed, is not significantly different from the wild type strain with respect to the bone loss and disease in this experimental model. This data suggests that LtxA shows more of an association with disease than seen with Cdt.

In both the of the cdtB mutant and the ltxA mutant experiments, the level of antibody to Aa was higher in the Aa-inoculated groups compared to the preimmune sera. However, in neither case were antibody levels in the inoculated strains significantly different from the uninoculated strains; although the antibody levels were higher.