The gastric cell lines BGC823, SGC7901, MKN28, AGS and MGC803 were maintained in RPMI-1640 medium, and the Kato3 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS. All cells were maintained in an incubator (Shellab, Cornelius, Oregon, USA) at 5% CO₂ and 37°C. All cell lines were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). TRAIL) was purchased from Sigma-Aldrich (St Louis, MO, USA). RPMI-1640, DMEM and fetal bovine serum (FBS) were purchased from HyClone (Logan, Utah, USA). Acrylamide, methylene acrylamide, tris-base, ammonium peroxydisulfate, TEMED, glycine and SDS were purchased from Sangon Biotech, Inc. (Shanghai, China), and the PVDF membrane and chemiluminescence reagents were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).

In situ hybridization was performed as previously described with some modifications [10]. Total RNA was extracted from BGC823 cells using TRIzol (Life Technologies, CA USA), and reverse transcription of the total RNA and PCR of the DNA template for synthesis of the XIAP-AS probes were performed according to the manufacturer's instructions (Takara, Dalian, China). The primer sequences for PCR were XIAP-AS1: 5'-CATGCCATGGTACCCTGGGAGACAGAATGAAAAGC-3' (forward) and 5'-ACGCGTACGCCACCTGTGTTTCTCAGCCCTTCTCT-3' (reverse). The PCR product was purified, subcloned into the pGM-T vector and confirmed by DNA sequencing. The plasmid was linearized using either NcoI or SalI (NEB, Beverly, MA, USA) and used as a transcription template for the T7 or Sp6 RNA polymerases (NEB, Beverly, MA, USA) to generate the antisense and sense probes, respectively. The transcription reaction was as follows: 2 μl of biotin-conjugated dNTP mix (Roche, Basel, Switzerland), 2 μl of RNA polymerase, 2 μl of buffer, 1 μg of linearized DNA template, 0.5 μl of RNase inhibitor (NEB, Beverly, MA, USA), 1 μl of 100xBSA and DECP-treated water in a final volume of 20 μl. After 3 μm-thick tissue sections were deparaffinized, dehydrated and heated to 95°C in a microwave oven in 0.01 M citrate buffer (pH 6.0) for 15 min, the slides were treated with 0.3% Triton X-100 in DEPC-treated PBS for 10 min and 10 μg/ml proteinase K for 20 min at 37°C. The tissue sections were incubated with sense or antisense probes overnight at 48°C. After hybridization, the sections were washed three times with 2×SSC and incubated with streptavidin-conjugated Alexa Fluor 488 for 1 h at room temperature at a dilution of 1:100 (Sigma-Aldrich, St Louis, USA). Tissue sections were counterstained with DAPI, and immunofluorescence was observed using an Axio Observer A1 microscope (Carl Zeiss, Germany). The sense probe was used as the negative control.

Total RNA was extracted using TRIzol according to the manufacturer's instructions. The RNA purity and concentration were measured using a NanoDrop2000c spectrophotometer (A260:A280>1.8), and RNA integrity was evaluated by agarose gel electrophoresis combined with ethidium bromide staining. Reverse transcription was performed according to instructions provided by the manufacturer (Takara, Dalian, China). Briefly, contaminating genomic DNA was removed from 1 μg of total RNA with DNase at 42°C for 2 min. Next, 1 μl of the reverse transcription primer mixtures containing oligo (dT) and random primers, 1 μl of reverse transcriptase, 4 μl of 5× reverse transcription buffer and 4 μl of DEPC-treated water were added to the above DNase-treated RNA template in a total reaction volume of 20 μl. The reaction was incubated at 37°C for 15 min and then at 85°C for 5 sec before being stored at 4°C. Real-time PCR was performed with an Applied Biosystems 7500 detection system. For the reaction, 1 μl of cDNA, 12.5 μl of 2× SYBR Green I Master Mix, 10 pmol of the specific forward primer, 10 pmol of the reverse primer, and 0.5 μl of ROX II were combined, and DEPC-treated water was added to a final volume of 25 μl. The reaction parameters consisted of incubation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec. The relative target gene quantification was calculated using the 2^-ΔΔCt method [11], where ΔΔCt = [Ct (treated group) target gene – Ct (treated group) internal control] – [Ct (control group) target gene – Ct (control group) internal control]. β-Actin was used as the internal control. The primer sequences for real-time PCR were as follows: XIAP-AS1: 5'-TACCCTGGGAGACAGAATGAAAAGC-3' (forward) and 5'-CACCTGTGTTTCTCAGCCCTTCTCT-3' (reverse); XIAP: 5’-ATGACAGGGCTGGAAGTGACC-3’ (forward) and 5’-ACTATGTCCCAGTCAGGGCTCT-3’ (reverse); β-actin: 5’-CTTAGTTGCGTTACACCCTTTCTTG-3’ (forward) and 5’-CTGTCACCTTCACCGTTCCAGTTT-3’ (reverse). The primers were synthesized by Sangon Biotech Company (Shanghai, China).

ChIP-qPCR was performed as previously described [12] with some modifications. BGC823 cells stably infected with lentiviruses expressing either an XIAP-AS1 shRNA (pLenti-XIAP-AS1-shRNA) or a scrambled shRNA (pLenti-Scrambled-shRNA) were treated with 4% formaldehyde at room temperature for 15 min. Glycine was added to a final concentration of 125 mM to halt the cross-linking reaction. After being washed twice with ice-cold PBS, the cells were collected and resuspended in 600 μl of cell lysis buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.5% NP-40, 1.0% Triton X-100) containing proteinase inhibitors and centrifuged at 12,000 g for 1 min at 4°C. The pellets were then resuspended in lysis buffer and sonicated for 10 pulses at 20 sec per pulse, with 30 sec on ice between the pulses, and the resulting homogenates were centrifuged at 12,000 g for 10 min at 4°C. The supernatants were separately incubated with rabbit anti-Sp1 antibody, rabbit anti-AP-1 antibody or normal rabbit IgG antibody (Santa Cruz Biotechnology, CA, USA) overnight at 4°C. The next day, the immunocomplexes were incubated with Dynabeads Protein G (Life Technologies, CA, USA) for 2 h at 4°C and recovered using magnets. The chromatin–antibody–Dynabead complexes were washed three times with PBS and treated with 0.25 mg/ml proteinase K (Sigma-Aldrich, St Louis, MO, USA) at 37°C for 12 h. DNA was extracted, and PCR was performed. The PCR primers for the XIAP promoter were 5'-GGAGGGGGGTAAGATTTGAGAGGTA-3' (forward) and 5'–TTACAGTCATTAGGTGGGACGCTTT -3' (reverse).

The RIP experiments were conducted using the Magna RIP^™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, MA, USA) according to the manufacturer's instructions. Briefly, the rabbit anti-Sp1 antibody, rabbit anti-AP-1 antibody or rabbit normal IgG antibody was incubated with the cellular extracts overnight at 4°C (Santa Cruz Biotechnology, CA, USA), and 10% of the cellular extracts was used as the input control and stored at -80°C. The next day, Dynabeads Protein G (Life technology, CA, USA) were added to the complex, the mixture was incubated for 2 h at 4°C and the immunoprecipitates were recovered using magnets. RNA molecules from the immunoprecipitates and from the 10% of the input control were extracted using TRIzol, and reverse transcription was performed. Gene specific primers for XIAP-AS1 were then used for real-time PCR.

Full-length XIAP-AS1 and deletion mutants were synthesized and subcloned into pcDNA3.1 by Beijing GENEWIZ Inc. (Beijing, China), and the cloned sequences were confirmed by sequencing. Transfection of XIAP-AS1 and the deletion mutants was performed using the lipofectamine 3000 reagent (Life Technologies, CA, USA). In brief, MNK28 cells were inoculated in 60-mm dishes and cultured for 24 h. Then, 5 μg of vector complexed with 7.5 μl of lipofectamine 3000 was transfected into MNK28 cells. Cells were incubated for an additional 48 h, and RIP assays for Sp1 or IgG were then performed. Relative enrichment of XIAP-AS and of the deletions was determined using qRT-PCR. The primer sequences for XIAP-AS and the deletion mutants were as follows: 5'-AGACGGACTCTTGCTGTGTCGCCCA-3' (forward), 5'-CCCAGGCTCAGGCAGTCCTTCCACC-3' (reverse). SiRNA transfection was performed as previously described [13] with slight modifications. Briefly, XIAP siRNA or scrambled siRNA was transfected into BGC823 cells using lipofectamine 3000. After 48 h, the treated cells were collected. The sequences for the XIAP siRNA were 5'-GGAGAUACCGUGCGGUGC-3' (sense) and 5'-GCACCGCACGGUAUCUCCdtdt-3' (antisense). The negative control siRNA sequence was 5'-UUCUCCGAACGUGUCACGdtdt-3' (sense) and 5'-CGUGACACGUUCGGAGAA-3' (antisense).

The XIAP protein was measured with mouse anti-XIAP antibody (Santa Cruz, CA, USA) by western blot. The cells were collected, washed with prechilled PBS, and lysed in RIPA buffer (Millipore, MA, USA) before the protein concentrations were measured with a BCA kit (Thermo Fisher Scientific, Waltham, MA, USA). Western blotting was performed as previously reported [10]. The primary antibodies, rabbit anti-XIAP, anti-caspase-3, anti-caspase-9, and mouse anti-β-actin (1:1000 dilution), were individually added to the membranes and incubated overnight at 4°C. The next day, the membranes were repeatedly washed in 0.1% TBST (tris-buffered saline and Tween-20) and subsequently incubated with a secondary HRP-conjugated goat anti-rabbit IgG antibody or an HRP-conjugated goat anti-mouse IgG antibody (1:4,000 dilution) at room temperature. All the primary and secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Approximately 1x10⁷ BGC823 cells were resuspended in 500 μl of cytoplasmic extract buffer with NP40 (10 mM HEPES, 60 mM KCl, 1 mM EDTA, 0.075% (v/v) NP40, 1 mM DTT and 1 mM PMSF, pH 7.6) and incubated on ice for 3 min. The extracts were subjected to centrifugation at 1500 g for 4 min, and the cytoplasmic supernatants were then transferred to a clean tube. The nuclear pellets were resuspended in 100 μl of nuclear extraction buffer (20 mM tris-HCl, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM PMSF and 25% (v/v) glycerol, pH 8.0) and vortexed for 1 h at 4°C. The nuclear extracts were then collected by centrifugation at 12,000 g for 10 min. RNA derived from the cytoplasmic and nuclear extracts was extracted using TRIzol (Life Technologies, CA, USA), and XIAP-AS1 was verified using qRT-PCR. U6 RNA and GAPDH mRNA were selected as the nuclear and cytoplasmic control transcripts, respectively. The primers for U6 RNA were 5'-CTCGCTTCGGCAGCACA-3' (sense) and 5'-AACGCTTCACGAATTTGCGT-3' (antisense). The primers for GAPDH mRNA were 5'-AGAACATCATCCCTGCCTCTACTGG-3' (sense) and 5'-CCTGCTTCACCACCTTCTTGATGTC-3' (antisense).

The pLenti-XIAP-AS1-shRNAand pLenti-Scrambled-shRNA lentiviruses were constructed by the Shanghai Hanbio Biotechnology Company (Shanghai, China). All the shRNAs were comprised of a short sense strand of 19 nucleotides followed by a loop of 9 nucleotides and the analogous antisense strand. The shRNAs were subsequently subcloned into the pLenti-super vector. Lentivirus packaging was performed by the Shanghai Hanbio Biotechnology Company. The XIAP-AS1 shRNA sequences were 5′-GATCCAAAAGAGAGAGAGAGGGATTCGAGAATCCCTCTC TCTCTCTTTTTTTTTG-3′ (sense) and 5′-AATTCAAAAA AAAAG AGAGAGAGA GGGATTCGAGAATCCCTCTCTCTCTCTTTTG-3′ (antisense). The negative control shRNA sequence was 5'-GATCCTTCTCCGAACGTGTCACGTCTCGAGAC GTGACACGTTCGGAGAATTTTTG-3' (sense) and 5'-AATTCAAAAATTCTCCG AACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAAG-3' (antisense). BGC823 cells (1x10⁵) were inoculated onto a 6-well plate 24 h prior to the lentiviral transfection. Lentivirus (5 μl) was individually added to the wells and mixed gently. The next day, 6 μg/ml polybrene (Sigma-Aldrich, St Louis, USA) in 1 ml of fresh culture medium was added and incubated for 4 h, and then 1 ml of fresh culture medium was added again. After infection for 24 h, fresh culture medium with 500 ng/ml puromycin was added, and the cell clones were selected after two weeks. XIAP expression was detected by qRT-PCR.

The tumor tissues used for IHC were obtained from BGC823 shRNA-XIAP-AS1 or shScramble cells. The 4 μm paraffin-embedded sections were deparaffinized, rehydrated. The procedures of IHC for XIAP were performed according to the proctocol [14]. The sections were incubated with mouse anti-XIAP antibody (Santa Cruz, CA, USA) diluted as 1:200 overnight at 4°C. Normal rabbit IgG antibody used as negative control. The sections were developed with 3, 3′-diaminobenzidine tetrahydrochloride (DAB) after being incubated with HRP-conjugated goat anti-mouse secondary antibody (Zhongshan Goldbridge Biotechnology, China) and then the slides were counterstained using Mayer’s hematoxylin.

Apoptosis was measured by Annexin V staining using a Cell Apoptosis Detection kit (Beyotime Biotechnology, Jiangsu, China) according to the manufacturer’s instructions, and the percentage of apoptotic cells was determined by flow cytometry (BDAccuri C6, BD Biosciences, Franklin Lakes, NJ, USA). Briefly, BGC823 stable cells infected with either the pLenti-shRNA-XIAP-AS1 or pLenti-shScramble cells were treated with 100 ng/ml TRAIL for 24 h, and the cells were then trypsinized and washed with cold PBS. The cells were harvested by centrifugation at 1,000 g for 5 min, and the pellet, containing approximately 1.0 × 10⁵ cells, was resuspended in 195 μl of binding buffer before being incubated with 5 μl of Annexin V-FITC and 10 μl of PI (Sigma-Aldrich, St Louis, USA) at room temperature for 10 min in the dark. The cells were subsequently collected and washed with cold PBS, and the percentage of apoptotic cells was analyzed using flow cytometry.

All animal experiments were approved by the Health Sciences Animal Policy and Welfare Committee of Beijing Friendship Hospital Affiliated to Capital Medical University. In the present study, six-week-old female BALB/c nude mice (nu/nu; n = 6) (Beijing Weitong Lihua Experimental Animals Company, China) were anesthetized with an isoflurane/propylene glycol mixture, and BGC823 stable cell lines with pLenti-shRNA-XIAP-AS1 or pLenti-shScramble cells were subcutaneously injected into the right flank of each mouse (1.0 × 10⁶ cells in 100 μl of RPMI 1640 medium per flank). After one week, TRAIL at a dose of 100 μg/mouse was injected directly into the tumor at multiple sites. Every two days, the above treatment was repeated. The tumor sizes were assessed weekly by measuring two dimensions, [length (a)] and [width (b)], and the tumor volumes were calculated as V = ab²/2, [15]. The mice were euthanized by CO₂ inhalation after 30 days, and the tumors were collected and weighed. Mice were handled according to the guidelines of the Health Sciences Animal Policy and Welfare Committee of Beijing Friendship Hospital Affiliated to Capital Medical University. Total protein was extracted from each tumor, and the levels of cleaved caspase-3 and caspase-9 were determined by western blot.

Statistical analysis was performed using SPSS 11.0. Data are presented as the mean ± standard error (SE) using two way analysis of variance (ANOVA). Differences were considered statistically significant when p < 0.05.

According to information regarding the XIAP gene, XIAP-AS1 is transcribed from the complementary strand (Fig 1A). We initially determined XIAP-AS1 and XIAP expression using qRT-PCR. XIAP-AS1 was expressed at various levels in all the gastric cancer cell lines, and XIAP-AS1 expression was positively correlated with XIAP expression (Fig 1B and 1C). Also, the levels of XIAP-AS1 in stomach adenocarcinoma (n = 285) and normal tissues (n = 33) derived from TCGA were analyzed and the results showed that XIAP-AS1 was highly expressed in stomach adenocarcinoma (S1A Fig). However, there was no significant correlation between the levels of XIAP-AS1 and survival probability (P = 0.07) (S1B Fig). Subsequently, we probed the location of XIAP-AS1 in gastric cancer cells using RNA FISH and determined that XIAP-AS1 was mostly distributed in the nucleus (Fig 1D). This nuclear location was further confirmed by isolating the cytoplasmic and nuclear extracts followed by qRT-PCR XIAP-AS1 (Fig 1E). The nuclear location of XIAP-AS1 suggests that XIAP-AS1 may play a role in XIAP gene transcription and/or mRNA precursor alternative splicing.

Since XIAP-AS1 is derived from the strand complementary to XIAP, we speculated XIAP-AS1 to be a potential candidate for regulating XIAP expression. To test this hypothesis, we stably overexpressed XIAP-AS1 in MNK28 cells and stably knocked down XIAP-AS1 in BGC823 cells. We observed that XIAP-AS1 overexpression has led to an increase in XIAP expression, whereas XIAP-AS1 knockdown led to a corresponding decrease of XIAP expression (Fig 2A and 2B), suggesting the involvement of XIAP-AS1 in enhancing XIAP transcription. Next, XIAP was knocked down, which did not alter the XIAP-AS1 transcript levels (Fig 2C), further indicating that XIAP-AS1 participates in the regulation of XIAP transcription.

Sp1, a known transcription factor, has been shown to mediate XIAP transcription. Thus, we speculated that XIAP-AS1 interacts with Sp1 to regulate XIAP gene transcription. Therefore, to ascertain an interaction between XIAP-AS1 and Sp1, we performed RIP assays in BGC823 and SGC7901 cells and probed for Sp1. The RIP assay suggested an interaction between XIAP-AS1 and Sp1 (Fig 2D), consistent with our expectations. ChIP assays comparing the BGC823 shRNA-Scramble and BGC823 shRNA-XIAP-AS1 cell lines showed decreased Sp1 binding to the XIAP promoter in the BGC823 shRNA-XIAP-AS1 cells (Fig 2E), suggesting that XIAP-AS1 increases Sp1 binding to the XIAP gene promoter to enhance XIAP transcription.

To identify the region of XIAP-AS1 required for its interaction XIAP-AS1 with Sp1, we performed RIP assays for Sp1 using various XIAP-AS1 deletion mutants. In contrast to full-length XIAP-AS1, none of the XIAP-AS1 deletion mutants pulled down SP1 (Fig 3A and 3B). Additionally, none of the XIAP-AS1 deletions had an effect on XIAP expression, whereas full-length XIAP-AS1 prompted XIAP up-regulation (Fig 3C). These results show that full-length XIAP-AS1 is indispensable for the interaction between XIAP-AS1 and Sp1.

To examine the effect of XIAP-AS1 knockdown on TRAIL-induced apoptosis, we quantified the percentage of apoptotic cells using flow cytometry with Annexin V staining after either the BGC823 shScramble or the shRNA-XIAP-AS1 cells exposed to TRAIL. We observed no obvious apoptosis in either the shScramble cells or the shRNA-XIAP-AS1 cells in the absence of TRAIL treatment. However, upon treatment with TRAIL, apoptosis in the shRNA-XIAP-AS1 cells increased (Fig 4A and S2A Fig). Conversely, TRAIL induced apoptosis of MNK28 cell and overexpression of XIAP-AS1 in MNK28 cells inhibited TRAIL-induced apoptosis (Fig 4B and S2B Fig). To examine whether XIAP-AS1 knockdown enhanced TRAIL-induced cell apoptosis via caspase activation, we measured caspase cleavage in BGC823 shRNA-XIAP-AS1 cells treated with TRAIL. TRAIL treatment resulted in caspase (caspase-3 and caspase-9) cleavage after XIAP-AS1 knockdown XIAP-AS1. In response to XIAP-AS1 knockdown, the 32 kDa pro-caspase-3 protein was cleaved to a 20 kDa intermediate and the active p17 subunit (Fig 4C). Levels of the precursor protein pro-caspase-9 were also subjected to proteolysis in response to XIAP-AS1 knockdown. These results suggest that XIAP-AS1 knockdown enhances TRAIL-induced apoptosis via promotion of caspase protein activation.

To investigate whether XIAP-AS1 knockdown promotes TRAIL-induced apoptosis and thereby inhibits the proliferation of cancer cells in vivo, we intratumorally administered TRAIL to tumors resulting from BGC823 shScramble and shRNA-XIAP-AS1 cells. Visually, the mean tumor volumes of the shRNA-XIAP-AS1 cells were smaller than those of the shScramble cells (Fig 5A). To confirm this observed difference, the whole tumor tissues were weighed after the mice were sacrificed. The weight of the tumor tissues from the shRNA-XIAP-AS1 cells were lighter than those of the controls (Fig 5B and 5C). Immunohistochemistry staining for XIAP showed that XIAP expression was down-regulated in shRNA-XIAP-AS1 tumor tissues, compared to shScramble (Fig 5D). Next, we measured the expression levels of cleaved caspase-3 and caspase-9 in the XIAP-AS1 knockdown and control tumor tissues. Western blot analysis for caspase-3 and caspase-9 demonstrated that pro-caspase-3 and pro-caspase-9 were subjected to more proteolytic processing in the shRNA-XIAP-AS1 tumor tissues than in the control tumor tissues (Fig 5E). Our results further indicate that XIAP-AS1 knockdown promotes cellular apoptosis induced by TRAIL in vivo.