PLoS ONE plos plosone PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0249117 PONE-D-20-18789 Research Article Biology and life sciencesDevelopmental biologyCell differentiation Biology and life sciencesCell biologyCellular typesAnimal cellsBlood cellsWhite blood cellsAlveolar macrophages Biology and life sciencesCell biologyCellular typesAnimal cellsImmune cellsWhite blood cellsAlveolar macrophages Biology and life sciencesImmunologyImmune cellsWhite blood cellsAlveolar macrophages Medicine and health sciencesImmunologyImmune cellsWhite blood cellsAlveolar macrophages Biology and life sciencesCell biologyCellular typesAnimal cellsImmune cellsAntigen-presenting cellsDendritic cells Biology and life sciencesImmunologyImmune cellsAntigen-presenting cellsDendritic cells Medicine and health sciencesImmunologyImmune cellsAntigen-presenting cellsDendritic cells Biology and life sciencesImmunologyImmune responseInflammation Medicine and health sciencesImmunologyImmune responseInflammation Medicine and health sciencesClinical medicineSigns and symptomsInflammation Biology and life sciencesCell biologyCellular typesAnimal cellsBlood cellsWhite blood cellsMacrophages Biology and life sciencesCell biologyCellular typesAnimal cellsImmune cellsWhite blood cellsMacrophages Biology and life sciencesImmunologyImmune cellsWhite blood cellsMacrophages Medicine and health sciencesImmunologyImmune cellsWhite blood cellsMacrophages Research and analysis methodsSpectrum analysis techniquesSpectrophotometryCytophotometryFlow cytometry Biology and life sciencesCell biologyCellular typesAnimal cellsImmune cells Biology and life sciencesImmunologyImmune cells Medicine and health sciencesImmunologyImmune cells Biology and life sciencesCell biologyCellular typesAnimal cellsBone marrow cells Generation and utilization of a HEK-293T murine GM-CSF expressing cell line HEK-293T murine GM-CSF cell line https://orcid.org/0000-0003-1427-3897 Robinson Elektra Kantzari Data curation Formal analysis Methodology Visualization Writing – original draft Writing – review & editing https://orcid.org/0000-0002-7197-9952 Covarrubias Sergio Conceptualization Methodology Project administration Supervision Writing – review & editing https://orcid.org/0000-0001-8695-7943 Zhou Simon Data curation Methodology Writing – review & editing Carpenter Susan Conceptualization Funding acquisition Supervision Writing – review & editing * Department of Molecular, Cell and Developmental Biology, University of California Santa Cruz, Santa Cruz, CA, United States of America MacDuff Donna A. Editor University of Illinois at Chicago College of Medicine, UNITED STATES

The authors have declared that no competing interests exist.

 * E-mail: sucarpen@ucsc.edu 9 4 2021 2021 16 4 e0249117 18 6 2020 11 3 2021 2021 Robinson et al This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Macrophages and dendritic cells (DCs) are innate immune cells that play a key role in defense against pathogens. In vitro cultures of bone marrow-derived macrophages (BMDMs) and dendritic cells (BMDCs) are well-established and valuable methods for immunological studies. Typically, commercially available recombinant GM-CSF is utilized to generate BMDCs and is also used to culture alveolar macrophages. We have generated a new HEK-293T cell line expressing murine GM-CSF that secretes high levels of GM-CSF (~180 ng/ml) into complete media as an alternative to commercial GM-CSF. Differentiation of dendritic cells and expression of various markers were kinetically assessed using the GM-CSF HEK293T cell line, termed supGM-CSF and compared directly to purified commercial GMCSF. After 7–9 days of cell culture the supGM-CSF yielded twice as many viable cells compared to the commercial purified GM-CSF. In addition to differentiating BMDCs, the supGM-CSF can be utilized to culture functionally active alveolar macrophages. Collectively, our results show that supernatant from our GM-CSF HEK293T cell line supports the differentiation of mouse BMDCs or alveolar macrophage culturing, providing an economical alternative to purified GM-CSF.

 National Institutes of Health (US) R21AR070973 Carpenter Susan Work on this project was supported by R21AR070973 to Susan Carpenter, an award from the National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS). Additional support was obtained from startup funds from UCSC to the Carpenter lab. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Sergio Covarrubias received partial support from the R21AR070973 for his salary. Data Availability Our vector maps are available in supplemental materials. The extended methods are also available on protocol.io (dx.doi.org/10.17504/protocols.io.bpkkmkuw). Our vectors and HEK-293T mGM-CSF cell line are available directly from the Carpenter lab email: sucarpen@ucsc.edu or can be requested from UCSC office of research via Jeffrey Jue, jljue@ucsc.edu, or innovation@ucsc.edu. Introduction

Colony-stimulating factors (CSF) including macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G-CSF), and granulocyte-macrophage colony stimulating factor (GM-CSF also known as colony stimulating factor 2, CSF2) are crucial for survival, proliferation, differentiation and functional activation of hematopoietic cells, including macrophages and dendritic cells (DCs) [1]. Macrophages and DCs are innate immune cells found in tissues and lymphoid organs that play a key role in defense against pathogens [2]. While there are a multitude of macrophage and dendritic cell subsets, GM-CSF is critical for the development of conventional dendritic cells (cDCs) and alveolar macrophages (AMs) [2]. Due to cell number limitations from harvesting cDCs and AMs directly from mice, well-established in vitro culturing of bone marrow and bronchoalveolar lavage fluid for dendritic cells and alveolar macrophages, respectively, using GM-CSF have become invaluable for immunological and molecular biology studies [2]. This has led to the use of CSF proteins in the purified form, as well as to the generation of recombinant cell lines that secrete the desired protein in the supernatant for cost efficiency [3–6]. One of the most widely adapted cell lines, utilized for differentiating and culturing murine bone-marrow derived macrophages (BMDMs) is the NCTC clone 929 strain L line, also known as L929 [7]. Supernatant from cultured L929 can be utilized, in lieu of purified M-CSF, to culture and differentiate BMDMs because it secretes murine M-CSF [7].

The Human embryonic kidney 293T (HEK293T) cell line is the ideal choice for expressing a CSF protein, for differentiating primary immune cells from mouse bone marrow, as it has been shown not to express innate immune pattern recognition receptors or naturally secrete immune-related cytokines [8, 9]. This ensures that only your protein of choice is predominantly expressed and that there is no inadvertent activation of the inflammatory cascade. Previously, murine GM-CSF has been cloned into J558L, a mouse B myeloma cell line [4], which is known to express cytokines, including IL10 [10]. Using J558L can therefore alter the results of in vitro experiments, by activating anti-inflammatory pathways when cultured with BMDCs or alveolar macrophages.

In this study we constructed HEK293T cell lines stably expressing and secreting murine GM-CSF. We utilized GM-CSF to generate and culture BMDCs and alveolar macrophages (AMs). HEK293T cells have no expression of human GM-CSF and the constructed cell lines, thus express only the stably transfected murine GM-CSF. We have found that our line is very stable, producing GM-CSF at a concentration of ~200 ng/ml even following freeze thaw cycles. We differentiated BMDCs and cultured AMs using our supGM-CSF and compared them to commercially available purified GM-CSF (pGM-CSF) and found that our supGM-CSF yields a higher number of cells, purity of DCs is not altered, and the cells show intact immune signaling cascades.

 Materials and methods Cloning strategy of mGM-CSF

The mGM-CSF gene, including PspXI and NotI restriction sites, was amplified from the pCR3.1-mGM-CSF vector (Addgene, 74465). The PCR was set up with: 25 μl 2X Phusion High-Fidelity PCR Master Mix (Thermo Scientific), 1 μl PspXI_hMCSF_fwd (20mM): TCCGCTCGAGCCACCATGTGGCTGCAGAATTTACTTTTCC, 1 μl NotI_hMCSF_rev (20mM): GACGCGGCCGCTCATTTTTGGCCTGGTTTTTTGC, 1 μl pCR3.1-mGM-CSF (20ng) and 22 μl DEP-C nuclease-free water. PCR program: 95°C 3 minutes, 35 cycles of 95°C 30 sec, 60°C 30 sec, and 72°C 1 min, and end the PCR with 72°C and 12°C hold. The PCR product was purified using the PCR Clean-up Kit (Macherey-Nagel) and was subsequently digested with PspXI (New England BioLabs) and NotI-HF (New England BioLabs) using recommended digestion conditions (https://nebcloner.neb.com/#!/redigest) and was cloned into our custom pSico bidirectional lentiviral vector (sequence in supplemental). Sequence was confirmed by Sequetech (Sanger) sequencing.

 Lentivirus generation

HEK-293T (ATCC CRL-3216) cells (4e5 cells/well) were plated onto a 6-well plate (353046, Corning) with complete DMEM [10% heat-inactivated FCS (Gibco, 26140–079), 100 μg/ml penicillin (Thermo, 15140122), and 100 μg/ml streptomycin (Thermo, 15140122)]. 24 hr later, 500 ng of pSico-mGM-CSF or empty vector control, 250 ng psPAX2 (Addgene, 12260), and 250ng pMD2.G (Addgene, 12259) were mixed in 200μl of serum-free Opti-MEM (Gibco) and 5μl Lipofectamine 2000 (Thermo Fisher) was added to mix and incubated for 20 minutes at room temperature. Transfection reaction was added to HEK-293T cells and allowed to transfect for 72 hr, and supernatant was harvested, passed through 0.45μm filters (Millipore, Stericup), and aliquots were stored at -80°C.

 Construction of GM-CSF-producing HEK-293T Cells

HEK-293T cells were transduced 2 days with 200 μl of lentivirus per 1e5 cells. 48 hr after infection, the HEK-293T cells were selected with puromycin (2 μg/ml) for >3 days, monitoring viability and increase of mCherry expression using FACS (Attune NxT Flow Cytometer). Once mCherry expression exceeded 85%, puromycin was removed, and cell-line was expanded and used to produce GM-CSF. A detailed method for GM-CSF supernatant production is described in S2 File.

 Enrichment of DCs and macrophages from BM and in-vitro stimulation

Bone marrow (BM) cells were harvested from the femurs and tibia of wild-type C57BL/6 between 6- and 18-weeks old mice and depleted of erythrocytes using red blood cell (RBC) lysis (Biosciences 786–649). 1e6-3e6 BM cells were plated per well of a 6-well tissue culture plate (353046, Corning) in complete DMEM supplemented with either 10% M-CSF from L929 cells, 5–10% supernatant from the mGM-CSF 293T cell line, or 10–25 ng/ml of recombinant mGM-CSF [PMC2015, Thermo Fisher]. Media was replaced on day 3 and every 2 days henceforward. Cells were scraped and moved onto a larger plate as they proliferated. After 7 to 14 days of enrichment, cells were stimulated by adding 200 μg/ml LPS (Sigma, L2630-10MG) to the media and harvested for analysis after 0, 6, or 24 hr of stimulation. Total cell count was determined by staining cells with trypan blue and using a Light Microscope and hemocytometer.

 Western blot

Undiluted supernatant was loaded from .9–3.6 ng, which was quantified by ELISA. 1μg of recombinant GM-CSF (Cat#576302) was used as a positive control. Each sample was resolved by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane and Western blotted with either mGM-CSF antibody (1:500, R&D DY415-05) and horseradish peroxidase-conjugated b-actin monoclonal antibody (1:5,000, Santa Cruz Biotechnology) were used as a loading control. HRP-conjugated streptavidin (1:60, R&D DY415-05) secondary antibodies were used.

 Surface staining for flow cytometry

Stimulated BMDCs and BMDMs were harvested and centrifuged at 300 g for 5 minutes. The pellets were resuspended in 100 μl sorting media (2% FCS, 5 mM EDTA, 1X PBS). Each sample was blocked with 100 μl of Fc block CD16/CD32 (BD Biosciences) diluted 1:250 in sorting media and incubated at room temperature for 15 minutes. Antibodies and viability dye were then used to stain the samples for 30 minutes on ice in the dark. Antibodies and dye: APC-eFluor 780 anti-CD45 (Invitrogen, 47-0451-82), Alexa-Fluor 700 anti-CD11c (BD Pharmingen, 560583), FITC anti-CD11b (Thermo Fisher, MA1-10081), PE-eFluor 610 anti-F4/80 (eBioScience, 61-4801-80), PE anti-MHC Class II (BD Pharmingen, 562010), and Fixable Aqua Dead Cell Stain (Thermo Fisher, L34957). Cells were washed twice in 1 ml sorting media, spinning at 300 g for 5 minutes. The resulting pellet was resuspended in 200 μl of sorting media and analyzed by FACS (Attune NxT Flow Cytometer).

 Inflammasome activation assay and ELISA

supGM-CSF (25 ng/ml) or recGM-CSF (25 ng/ml) differentiated BMDCs were plated at 2e5cells/well in a 96 well plate with complete DMEM media. Cells were first primed with 200 ng/ml LPS for 3 hr prior to treatment with different agents. Poly(dA:dT) DNA (dsDNA mimic) was transfected using Lipofectamine 2000 at a concentration of 1.5 μg/ml, 6 hr prior to harvesting supernatant. The supernatant was harvested using a p300 multichannel pipette and stored at -80°C. Commercial ELISAs were used to measure the following proteins in mice in triplicate following the manufacturer’s instructions: IL6 (mouse IL6 DuoSet, R&D Systems DY406), IL1β (Mouse IL-1β/IL-1F2 R&D Systems DY401-05) and mGM-CSF (Mouse GM-CSF DuoSet Systems DY415-05).

 BALF harvest and alveolar macrophage culturing

Bronchoalveolar Lavage Fluid (BALF) was harvested as previously stated by Cloonan et al. (PMID:26752519). 40 mice were euthanized by CO2 narcosis, the tracheas cannulated, and the lungs lavaged with 0.5-ml increments of ice-cold PBS eight times (4 ml total), samples were combined in 50 ml conical tubes. BALF was centrifuged at 500 g for 5 min. 1 ml red blood cell lysis buffer (Sigma-Aldrich) was added to the cell pellet and left on ice for 5 min followed by centrifugation at 500 g for 5 min. The cell pellet was resuspended in 500 μl PBS, and leukocytes were counted using a hemocytometer. Specifically, 10 μl was removed for cell counting (performed in triplicate) using a hemocytometer. Cells were plated in sterile 12 well plates at 5e5/well (total of 8 wells) and use complete DMEM with 25 ng/ml supGM-CSF.

 Culturing of alveolar macrophages

24 hr post-BALF isolation, media was removed and fresh complete DMEM with 25 ng/ml supGM-CSF is added. All cells that adhere to the surface of the plate are considered alveolar macrophages (AM) as previously determined by Chen et al. [11]. After new media is added, AMs are stimulated with 200 ng/ml LPS (Sigma, L2630-10MG). Harvest supernatant 6 hr post-stimulation. Harvested supernatant was sent to Eve technologies for cytokine analysis. Statistics were performed using GraphPad prism.

 Cytotoxicity assay

Cytotoxicity was assessed by measuring the release of LDH into the media (LDH-Cytotoxicity Colorimetric Assay Kit II; BioVision) according to the manufacturer’s protocol.

 Ethics statement

All animal work was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee at the University of California Santa Cruz (Protocol number CARPS1810).

 Results Production of a murine GM-CSF-secreting HEK-293T cell line

A murine GM-CSF (mGM-CSF) containing plasmid (Addgene, 74465) was used as a template to amplify mGM-CSF, which we inserted into a plasmid with a pSico backbone (S1 Fig, S1 File). The vector contains a bidirectional EF1a promoter driving puromycin resistance gene and mCherry on one side and mGM-CSF on the other (S1B Fig, Fig 1A). Lentivirus containing mGM-CSF, or a control construct was generated and transduced into HEK293Ts and monitored using flow cytometry (S2 Fig). Post puromycin selection for 7 days, our control and mGM-CSF constructs were incorporated into the genomes of HEK293T cells (at a rate of >85%) (Fig 1B). In order to determine how much GM-CSF was being produced by the HEK293T line we plated and grew 2x106 cells for 3 days, isolated the supernatant and performed an ELISA to measure the concentration which was found to be 181.7 ng/ml (S2 File). Additionally, GM-CSF protein size was assessed by western blot showing it is running as a single band at ~17kDa (S3 Fig). The cell line was subsequently frozen down into aliquots and thawed to assess stability. Protein secretion was assessed again, by ELISA, and the stock secreted mGM-CSF at 181.9±ng/ml (Fig 1C). There was no significant difference between the concentration of mGM-CSF in the supernatant of the initial or the freeze thawed HEK293T cell line indicating that the line is stable.

10.1371/journal.pone.0249117.g001 Generation of mouse GM-CSF secreting HEK293T cell line.

(A) Schematic of lentiviral plasmid construct used to generate the stable HEK293T mGM-CSF expressing cell line. (B) Uninfected, Control plasmid and mGM-CSF plasmid lentivirally infected HEK239T cells were puromycin selected for mCherry expression and assessed using flow cytometry. (C) Protein secretion and cell-line stability of mGM-CSF HEK293T cells was confirmed ELISA, using initial and stock cell-line. Error bars represent the standard deviation of biological triplicates. Student’s t-tests were performed using GraphPad Prism. (SN) indicates not significantly different.

 Bone-marrow cells differentiated with supGM-CSF yield a higher number of dendritic cells compared to pGM-CSF

To assess the efficacy of the mGM-CSF-rich supernatant (supGM-CSF), bone marrow (BM) cells were treated with 10 ng/ml or 25 ng/ml of supGM-CSF and compared to the same concentrations of a commercially obtained purified GM-CSF (pGM-CSF) [12–14]. As a control for differentiation, we also generated bone-marrow derived macrophages (BMDMs) using supM-CSF obtained from L929 cells [15] (Fig 2A).

10.1371/journal.pone.0249117.g002 Generation of primary dendritic cells using purified GM-CSF or supernatant GM-CSF.

(A) Schematic of differentiation of primary bone marrow-derived macrophages (BMMs) or primary bone marrow-derived dendritic cells (BMDCs). (B) Images of primary BMMs and BMDCs under a light microscope after 7 days of differentiation. (C) Total number of live cells generated from using one of 5 conditions: M-CSF, purified GM-CSF (pGM-CSF) at 10 ng/ml, pGM-CSF at 25 ng/ml, supernatant GM-CSF (supGM-CSF) at 10 ng/ml or supGM-CSF at 25 ng/ml. (D) Gating of CD45+ and CD11b+ M-CSF differentiated cells are represented in a quadrant contour plot to determine the expression of F4/80 and CD11c. Same gating strategy is used for (E) pGM-CSF at 10 ng/ml, (F) pGM-CSF at 25 ng/ml, (G) supGM-CSF at 10 ng/ml and (H) supGM-CSF at 25 ng/ml. (I) Graphical representation for the percentage of M-CSF or GM-CSF differentiated cells that are F4/80+ and CD11c+ (Q2). (J) Graphical representation for the mean fluorescence of CD11c+. (K) Graphical representation for the mean fluorescence of F4/80+. Error bars represent the standard deviation of n = 5. Student’s t-tests were performed using GraphPad Prism. Asterisks indicate statistically significant differences between mouse lines (*p ≥ 0.05, **p ≥ 0.01, ***p ≥ 0.005).

Cells incubated with M-CSF, pGM-CSF and supGM-CSF were fully differentiated by day 7 and could be cultured until day 14 (Fig 2A). Morphologically, BM differentiated with supGM-CSF and pGM-CSF, at either 10 ng/ml or 25 ng/ml, have a more stellate morphology as is expected in dendritic cells compared to M-CSF differentiated macrophage cells. There is no morphological difference between pGM-CSF or supGM-CSF differentiated cells, at either 10 ng/ml or 25 ng/ml (Fig 2B). At day 9 of differentiation, cells were harvested and counted. When comparing the pGM-CSF to the supGM-CSF, supGM-CSF yields significantly more viable cells in comparison to pGM-CSF (Fig 2C). After culture with M-CSF, pGM-CSF or supGM-CSF, cells were assessed for purity by flow cytometry based on previously published panels [16, 17]. After gating on Live+/CD45+/CD11b+ cells purity was determined based on the proportion of the population expressing CD11c and F4/80, shown as a quadrant (S4 Fig, Fig 2D–2H). Percent of cells in quadrant 2 (F4/80+ and CD11c+) was significantly higher for all GM-CSF treated cells, in comparison to M-CSF treated cells, as is expected since BMDMs express very little CD11c while BMDCs highly express CD11c. However, pGM-CSF and supGM-CSF were not significantly different (Fig 2I). As expected, the mean fluorescence intensity for dendritic cell marker CD11c+ cells were significantly higher for all GM-CSF treated cells in comparison to M-CSF (Fig 2J), while F4/80+ expression was equal for every treatment (Fig 2K). While supGM-CSF is able to generate more viable cells than pGM-CSF, there is no significant difference in cellular purity between supGM-CSF and pGM-CSF (both at ~85% purity).

 BMDCs generated using supGM-CSF function as efficiently as BMDCs generated using pGM-CSF

Dendritic cells are the professional antigen presenting cells of the immune system. In order to test the ability of our supGM-CSF to generate functional DCs we measured their levels of MHC-Class II (MHCII) expression using flow cytometry [18]. M-CSF differentiated cells express little MHCII, while pGM-CSF and supGM-CSF express robust levels of MHCII, when differentiated with 10 ng/ml or 25ng/ml concentration of GM-CSF (Fig 3A and 3B, S4A and S4B Fig). Dendritic cells differentiated with 10 ng/ml GM-CSF show statistically higher mean fluorescence intensity for MHCII for supGM-CSF in comparison to pGM-CSF (S5C Fig). Interestingly, dendritic cells differentiated with 25 ng/ml of either pGM-CSF or supGM-CSF exhibit no significant difference in overall MHCII protein expression when evaluated by mean fluorescence intensity (Fig 3C). On a more granular level, supGM-CSF appears to have a single population expressing high levels of MHCII in comparison to the two populations of cells generated by the pGM-CSF expressing low and high MHCII (Fig 3A and 3B). In addition to assessing MHCII levels, we also assessed the ability of the pGM-CSF and supGM-CSF BMDCs to respond to inflammatory stimulation. Both pGM-CSF and supGM-CSF BMDCs were stimulated with LPS (200 ng/ml) for the indicated time course and IL6 mRNA expression was measured by quantitative PCR (qPCR) (Fig 3C). Thus, determining that the supGM-CSF derived cells maintain their inflammatory activity. Finally, AIM2 inflammasome activity was measured through IL1b protein secretion of both purified and supernatant GM-CSF, while priming of the system with LPS alone was assessed by IL6 secretion. Here we observe that supGM-CSF produces significantly higher expression of IL6 at a protein level, but not transcriptionally (Fig 3D and 3E) suggesting that these dendritic cells are more sensitive to inflammatory activation compared to DCs generated using pGM-CSF.

10.1371/journal.pone.0249117.g003 Dendritic cells differentiated with supGM-CSF retain dendritic cell activity and are more inflammatory in comparison to pGM-CSF.

(A) Histogram overlay of CD45+ and CD11b+ M-CSF (grey) and pGM-CSF (pink) or (B) supGM-CSF (orange) differentiated cells expressing MHCII. (C) Graphical representation of MHCII mean fluorescence intensity (MFI) of M-CSF, pGM-CSF, or supGM-CSF differentiated cells. (D) Il6 transcript measure by RTq-PCR from pGM-CSF (pink) or supGM-CSF (orange) DCs stimulated with LPS for 0, 6, and 24 hr. (E) Dendritic cells differentiated with pGM-CSF (pink) or sup-GM-CSF (orange) were treated with lipofectamine, LPS (24 hr) or LPS (2 hr) and polydA:dT (6 hr) secreted IL-6 or IL-1β (E) was measured by ELISA. All experiments were performed in biological triplicate. Student’s t-tests were performed using GraphPad Prism. Asterisks indicate statistically significant differences between mouse lines (*p ≥ 0.05, **p ≥ 0.01, ***p ≥ 0.005).

 supGM-CSF can maintain viable and inflammatory inducible alveolar macrophages

mGM-CSF is a critical protein factor that is not only necessary for driving primary dendritic cell differentiation, but also for maintaining primary alveolar macrophages (AM) in culture [19, 20]. To test the ability of supGM-CSF to maintain AM in culture, we harvested bronchiolar lavage fluid (BALF) from 40 WT wild-type mice. We pooled these cells, counted and then plated them in 25 ng/ml supGM-CSF supplemented media. 24 hr post-harvest, using a light microscope, we tested that AMs attached (Fig 4). Viability of AMs were assessed by measuring the amount of lactate dehydrogenase (LDH) in the media. The amount of measured LDH correlates directly with the cell number lysed [21]. Our data indicate that supGM-CSF does not negatively affect the cell culture, while the controls indicate there are healthy cultured cells not resistant to apoptosis (Fig 4B). AMs were stimulated with LPS for 24 hr and cytokines were measured by ELISA. Inflammatory inducible proteins are significantly upregulated in AMs cultured in supGM-CSF media, including proteins IL6, TNFa, MDC, MCP-1, IP10, KC and Rantes (Fig 4C–4I). supGM-CSF cultured primary alveolar macrophages maintain their pro-inflammatory activation programming.

10.1371/journal.pone.0249117.g004 supGM-CSF can differentiate functional alveolar macrophages.

(A) Schematic of alveolar macrophage supGM-CSF harvesting and differentiating experiment. (B) The cellular viability of differentiated alveolar macrophages was measured by LDH, where media, cells, and lysis of cells were measured. (C) Secreted IL6 protein was measured from supGM-CSF differentiated alveolar macrophages treated with and without LPS for 6hr, as well as (D) TNFa, (E) MDC, (F) MCP-1, (G) IP10, (H) KC and (I) Rantes. All experiments were performed in biological triplicate. Student’s t-tests were performed using GraphPad Prism. Asterisks indicate statistically significant differences between mouse lines (*p ≥ 0.05, **p ≥ 0.01, ***p ≥ 0.005).

 Discussion

Dendritic cells and macrophages have been cultured and studied for the last 40 years, leading to many advances in culturing protocols. Flt3L is often utilized as a factor for BMDC differentiation, it is now appreciated that Flt3L DCs are representative of steady-state resident DCs, while GM-CSF BMDCs mirror the transcriptional programing of pro-inflammatory recruited cells [22, 23]. Granulocyte-macrophage colony-stimulating factor (GM-CSF), differentiated bone marrow cells are widely used as a model system for conventional DC development [24, 25], as well as sustaining primary alveolar macrophages in culture [26]. Current strategies for the generation of murine BMDCs or culturing of primary alveolar macrophages utilize store bought purified recombinant GM-CSF or a stable cell-line expressing recGM-CSF called J558L [10]. J558L, a murine GM-CSF, secreting cell-line is utilized for both BMDC and alveolar macrophage culturing, however it is an immune cell that also secretes IL-10 which can alter the transcriptional programing of the cells when culturing and only secretes 80 ng/ml [10, 19, 20].

Using supernatant from GM-CSF secreting HEK293T cells, can serve as an alternative to purified GM-CSF for murine BMDCs or maintenance of primary alveolar macrophages. We have successfully cloned and stably integrated murine GM-CSF into HEK293T cells, which consistently secrete 180 ng/ml of GM-CSF (Fig 1). GM-CSF protein size is predicted to be ~16 kDa. Our sup-GM-CSF runs as a single band in the supernatant at approximately 17 kDa. Purified GM-CSF obtained from biolegend runs at a smaller size of ~14.5 kDa. The size differential could be due to the way in which the recombinant protein is produced in E.Coli or that the protein produced from our cell lines contains modifications that result in it running at a higher molecular weight. Bone marrow differentiated with our supGM-CSF produces more cells by day 9 compared to pGM-CSF, but both GM-CSF sources generate an equal percentage of pure dendritic cells based on previously published gating strategies [16, 17] (Fig 1C and 1I). Additionally, using more GM-CSF also will produce more viable and proliferating cells, which can be further enhanced with higher concentrations of supGM-CSF (Fig 2C). Commercial GM-CSF can be used instead of our HEK293T supGM-CSF, but it is expensive, and GM-CSF has to be added every 2 days to cells during the differentiation process. Our supGM-CSF is much more cost effective compared to purified GM-CSF from a number of companies (S1 Table). From one harvest of supGM-CSF you can generate ~10 μg, which will be the cost of 50 ml of complete media (S2 File), while 10 μg of purified GM-CSF from Thermo Fisher will cost $276. The purity of BMDCs generated from pGM-CSF and supGM-CSF does not differ when assessed by flow cytometry based on previously published panels [16, 17] (S3 Fig, Fig 2D–2H).

DCs are professional antigen presenting cells and therefore express high levels of MHC Class II [22, 27]. BMDCs differentiated with either Flt3L or GM-CSF have comparable T cell activation, and therefore MHC II expression [23]. BMDCs differentiated using 25 ng/ml with either pGM-CSF or supGM-CSF express MHC-II at a comparable level (Fig 3C), when measured by mean fluorescence intensity (MFI) through flow cytometry, while on a more granule level it appears that the supGM-CSF has a purer population of cell expressing high MHCII compared to the pGM-CSF which has two distinct populations (Fig 3A and 3B). Interestingly, BMDCs differentiated with 10 ng/ml GM-CSF show statistically higher MFI for MHCII for supGM-CSF in comparison to pGM-CSF (S4A–S4C Fig). Based on previously reported data from Helft et al. we hypothesize that our supGM-CSF differentiates pure BMDCs because of the MHCII high expression, while the pGM-CSF generates a mixed population of BMDCs and BMDMs represented by the MHCII intermediate and high populations [28].

As previously stated, picking a cell line to express a recombinant protein is very important. If an immune cell is chosen, one risks the chance of having immune factors being secreted in the supernatant, leading to priming and activation of either pro- or anti- inflammatory transcriptional programs [10, 19, 20]. By performing a time-course stimulation or overnight LPS stimulation, our study indicates supGM-CSF does not inhibit the inflammatory program transcriptionally when measuring the transcript or protein level of IL6 (Fig 3D and 3E). supGM-CSF and pGM-CSF differentiated BMDCs both retain the ability to activate the inflammasome pathway, leading to the secretion of IL1b (Fig 3D–3F). While there has been published reports that it is macrophages within the population of cells that arise from the GM-CSF model of differentiation and not the DCs that are responsible for the inflammasome activation we can show here that our CD11c+/MHChi DC cells possess a functional AIM2 inflammasome [29].

Not only does our study provide data to support the use of supGM-CSF compared to pGM-CSF for BMDCs, but we also show that supGM-CSF can be utilized to sustain the culturing of primary alveolar macrophages from murine bronchoalveolar lavage fluid (BALF) [10, 19]. After 48 hr of supGM-CSF cultured BALF, the adhered alveolar macrophages (AMs) were >95% viable (Fig 4B). More importantly, when stimulating the cells with LPS overnight cytokines such as IL6, TNFa, KC and Rantes were all inducible (Fig 4C–4I). Thus, supGM-CSF maintains AMs in culture and does not inhibit the pro-inflammatory programming of the immune cells.

Taken together our results show that a pure BMDC population and inflammatory inducible DCs or AMs can be established by culturing BM cells or BALF with a crude supernatant from our GM-CSF HEK293T cell line. This line will provide the research community with a more cost-effective alternative to commercially available GM-CSF.

 Supporting information Validation of cloned murine GM-CSF.

(A) Image of PspXI and NotI digested PCR product of murine GM-CSF. (B) Detailed 266 vector map of mGM-CSF, restriction sites, promoter, antibiotic selection and mCherry sequence. (C) Alignment of Sanger sequencing results of mGM-CSF and 266 Vector map strategy. (D) Quality of sanger sequencing results of murine GM-CSF.

(TIF)

 mCherry expression in HEK293T cell line.

HEK-293T cell line lentiviral integration of GM-CSF was selected using puromycin (2 μg/ml) over a week. Flow cytometry was used to assess fluorescence intensity.

(TIF)

 Size quantification of pGM-CSF and supGM-CSF.

Western blot from left to right: 1 μg of pGM-CSF, Ladder, 20ul of 293T supernatant, 5 μl of supGM-CSF (0.9 ng), 10 μl (1.8 ng) of supGM-CSF, 15 μl (2.7 ng) of supGM-CSF and 20 μl (3.6 ng) of supGM-CSF.

(TIF)

 Gating strategy for identifying dendritic cell and macrophage populations.

M-CSF and GM-CSF differentiated cells were both put through the same gating strategy. The 5 gating plots are for the (A) M-CSF, (B) pGM-CSF (10 ng/ml), (C) pGM-CSF (25 ng/ml), (D) supGM-CSF (10 ng/ml), (E) supGM-CSF (25 ng/ml) differentiated cells. Non-debris cells were gated for in gate 1, then singlets in gate 2, followed by CD45+ and live cells were gated for in gate 3, then CD11b+ cells were gated in gate 4 finally this population of cells were visualized using F4/80+ and CD11c+ markers and gate were put into quadrants.

(TIF)

 Expression of MHC II on dendritic cell populations differentiated with 10ng/ml pGM-CSF or supGM-CSF.

(A) Histogram overlay of CD45+ and CD11b+ M-CSF (grey) and pGM-CSF (pink) or (B) supGM-CSF (orange) differentiated cells expressing MHC II. (C) Graphical representation of MHC II mean fluorescence of M-CSF, pGM-CSF, or supGM-CSF differentiated cells. Student’s t-tests were performed using GraphPad Prism. Asterisks indicate statistically significant differences between mouse lines (*p ≥ 0.05, **p ≥ 0.01, ***p ≥ 0.005).

(TIF)

 Cost of purified murine GM-CSF.

(TIF)

 <p>(APE)</p> </caption> </supplementary-material> <supplementary-material id="pone.0249117.s008" mimetype="application/vnd.openxmlformats-officedocument.wordprocessingml.document" position="float" xlink:href="info:doi/10.1371/journal.pone.0249117.s008" xlink:type="simple"> <label>S2 File</label> <caption> <title>Extended methods.

(DOCX)

 <p>(PDF)</p> </caption> </supplementary-material> </sec> </body> <back> <ref-list> <title>References Metcalf D. Hematopoietic cytokines. Blood. 2008;111: 485–491. doi: 10.1182/blood-2007-03-079681 18182579 Becher B, Tugues S, Greter M. GM-CSF: From Growth Factor to Central Mediator of Tissue Inflammation. Immunity. 2016;45: 963–973. doi: 10.1016/j.immuni.2016.10.026 27851925 Almo SC, Love JD. Better and faster: improvements and optimization for mammalian recombinant protein production. Curr Opin Struct Biol. 2014;26: 39–43. doi: 10.1016/j.sbi.2014.03.006 24721463 Karasuyama H, Melchers F. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors. Eur J Immunol. 1988;18: 97–104. doi: 10.1002/eji.1830180115 2831066 Kiselev Y, Eriksen TE, Forsdahl S, Nguyen LHT, Mikkola I. 3T3 cell lines stably expressing Pax6 or Pax6(5a)—a new tool used for identification of common and isoform specific target genes. PLoS ONE. 2012;7: e31915. doi: 10.1371/journal.pone.0031915 22384097 Klose D, Woitok M, Niesen J, Beerli RR, Grawunder U, Fischer R, et al. Generation of an artificial human B cell line test system using Transpo-mAbTM technology to evaluate the therapeutic efficacy of novel antigen-specific fusion proteins. PLoS ONE. 2017;12: e0180305. doi: 10.1371/journal.pone.0180305 28704435 Boltz-Nitulescu G, Wiltschke C, Holzinger C, Fellinger A, Scheiner O, Gessl A, et al. Differentiation of rat bone marrow cells into macrophages under the influence of mouse L929 cell supernatant. J Leukoc Biol. 1987;41: 83–91. doi: 10.1002/jlb.41.1.83 3543182 Razonable RR, Henault M, Lee LN, Laethem C, Johnston PA, Watson HL, et al. Secretion of proinflammatory cytokines and chemokines during amphotericin B exposure is mediated by coactivation of toll-like receptors 1 and 2. Antimicrob Agents Chemother. 2005;49: 1617–1621. doi: 10.1128/AAC.49.4.1617-1621.2005 15793154 Weichart D, Gobom J, Klopfleisch S, Häsler R, Gustavsson N, Billmann S, et al. Analysis of NOD2-mediated proteome response to muramyl dipeptide in HEK293 cells. J Biol Chem. 2006;281: 2380–2389. doi: 10.1074/jbc.M505986200 16257953 Qin Z, Noffz G, Mohaupt M, Blankenstein T. Interleukin-10 prevents dendritic cell accumulation and vaccination with granulocyte-macrophage colony-stimulating factor gene-modified tumor cells. J Immunol. 1997;159: 770–776. 9218594 Chen BD, Mueller M, Chou TH. Role of granulocyte/macrophage colony-stimulating factor in the regulation of murine alveolar macrophage proliferation and differentiation. J Immunol. 1988;141: 139–144. 3288696 Na YR, Jung D, Gu GJ, Seok SH. GM-CSF Grown Bone Marrow Derived Cells Are Composed of Phenotypically Different Dendritic Cells and Macrophages. Mol Cells. 2016;39: 734–741. doi: 10.14348/molcells.2016.0160 27788572 Roney K. Bone marrow-derived dendritic cells. Methods Mol Biol. 2013;1031: 71–76. doi: 10.1007/978-1-62703-481-4_9 23824889 Wang W, Li J, Wu K, Azhati B, Rexiati M. Culture and Identification of Mouse Bone Marrow-Derived Dendritic Cells and Their Capability to Induce T Lymphocyte Proliferation. Med Sci Monit. 2016;22: 244–250. doi: 10.12659/msm.896951 26802068 Weischenfeldt J, Porse B. Bone Marrow-Derived Macrophages (BMM): Isolation and Applications. CSH Protoc. 2008;2008: pdb.prot5080. doi: 10.1101/pdb.prot5080 21356739 Ono Y, Nagai M, Yoshino O, Koga K, Nawaz A, Hatta H, et al. CD11c+ M1-like macrophages (MΦs) but not CD206+ M2-like MΦ are involved in folliculogenesis in mice ovary. Sci Rep. 2018;8: 8171. doi: 10.1038/s41598-018-25837-3 29802255 Zaynagetdinov R, Sherrill TP, Kendall PL, Segal BH, Weller KP, Tighe RM, et al. Identification of myeloid cell subsets in murine lungs using flow cytometry. Am J Respir Cell Mol Biol. 2013;49: 180–189. doi: 10.1165/rcmb.2012-0366MA 23492192 Santin AD, Hermonat PL, Ravaggi A, Chiriva-Internati M, Cannon MJ, Hiserodt JC, et al. Expression of surface antigens during the differentiation of human dendritic cells vs macrophages from blood monocytes in vitro. Immunobiology. 1999;200: 187–204. doi: 10.1016/s0171-2985(99)80069-2 10416127 Busch C, Favret J, Geirsdóttir L, Molawi K, Sieweke M. Isolation and Long-term Cultivation of Mouse Alveolar Macrophages. BIO-PROTOCOL. 2019;9. doi: 10.21769/BioProtoc.3302 31909091 Shibata Y, Berclaz PY, Chroneos ZC, Yoshida M, Whitsett JA, Trapnell BC. GM-CSF regulates alveolar macrophage differentiation and innate immunity in the lung through PU.1. Immunity. 2001;15: 557–567. doi: 10.1016/s1074-7613(01)00218-7 11672538 Smith SM, Wunder MB, Norris DA, Shellman YG. A simple protocol for using a LDH-based cytotoxicity assay to assess the effects of death and growth inhibition at the same time. PLoS ONE. 2011;6: e26908. doi: 10.1371/journal.pone.0026908 22125603 Carreras E, Turner S, Paharkova-Vatchkova V, Mao A, Dascher C, Kovats S. Estradiol acts directly on bone marrow myeloid progenitors to differentially regulate GM-CSF or Flt3 ligand-mediated dendritic cell differentiation. J Immunol. 2008;180: 727–738. doi: 10.4049/jimmunol.180.2.727 18178810 Xu Y, Zhan Y, Lew AM, Naik SH, Kershaw MH. Differential development of murine dendritic cells by GM-CSF versus Flt3 ligand has implications for inflammation and trafficking. J Immunol. 2007;179: 7577–7584. doi: 10.4049/jimmunol.179.11.7577 18025203 Nikolic T, de Bruijn MFTR, Lutz MB, Leenen PJM. Developmental stages of myeloid dendritic cells in mouse bone marrow. Int Immunol. 2003;15: 515–524. doi: 10.1093/intimm/dxg050 12663681 Zhang Y, Harada A, Wang JB, Zhang YY, Hashimoto S, Naito M, et al. Bifurcated dendritic cell differentiation in vitro from murine lineage phenotype-negative c-kit+ bone marrow hematopoietic progenitor cells. Blood. 1998;92: 118–128. 9639507 Dong Y, Arif AA, Poon GFT, Hardman B, Dosanjh M, Johnson P. Generation and Identification of GM-CSF Derived Alveolar-like Macrophages and Dendritic Cells From Mouse Bone Marrow. J Vis Exp. 2016. doi: 10.3791/54194 27404290 ten Broeke T, Wubbolts R, Stoorvogel W. MHC class II antigen presentation by dendritic cells regulated through endosomal sorting. Cold Spring Harb Perspect Biol. 2013;5: a016873. doi: 10.1101/cshperspect.a016873 24296169 Helft J, Böttcher J, Chakravarty P, Zelenay S, Huotari J, Schraml BU, et al. GM-CSF Mouse Bone Marrow Cultures Comprise a Heterogeneous Population of CD11c(+)MHCII(+) Macrophages and Dendritic Cells. Immunity. 2015;42: 1197–1211. doi: 10.1016/j.immuni.2015.05.018 26084029 Erlich Z, Shlomovitz I, Edry-Botzer L, Cohen H, Frank D, Wang H, et al. Macrophages, rather than DCs, are responsible for inflammasome activity in the GM-CSF BMDC model. Nat Immunol. 2019;20: 397–406. doi: 10.1038/s41590-019-0313-5 30742078 10.1371/journal.pone.0249117.r001 Decision Letter 0 MacDuff Donna A. Academic Editor 2021 Donna A. MacDuff This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version 0

6 Oct 2020

PONE-D-20-18789

Generation and utilization of a HEK-293T murine GM-CSF expressing cell line

PLOS ONE

Dear Dr. Carpenter,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

                  

The reviewers request a numbers of clarifications in the manuscript text, and verification that the GM-CSF protein expressed from the transgene is of the expected size and was not fused to a cellular gene during the integration process. To ensure rigor and reproducibility, please clarify whether the data presented represent multiple independent experiments or replicates from a single experiments. Please double-check the statistical analyses, for example the data presented in Fig. 3F do not appear to be significantly different but are marked as so. Please add statistical analyses to Fig. 4B-I.

Please submit your revised manuscript by Nov 20 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Donna A. MacDuff, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for including your ethics statement: "In our work, we used mice for all experiments. These procedures were approved by IACUC, our number is CARPS1810.".

i) Please amend your current ethics statement to include the full name of the ethics committee that approved your specific study.

ii) Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE submissions requirements for ethics oversight of animal work, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-animal-research

3. Thank you for stating the following financial disclosure: 'SCa received R21AR070973 funding for this work.'

At this time, please address the following queries:

Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution.

State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

If any authors received a salary from any of your funders, please state which authors and which funders.

If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.”

**Please include your amended statements within your cover letter; we will change the online submission form on your behalf.**

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript, Robinson et al describe a new cell line that they have developed that expresses constitutively GM-CSF. This 293T derived cell line that expresses high levels of GM-CSF in the media, is a cheap and efficient alternate source of GM-CSF that is usually bought commercially at high cost. They provide an array of experiments that show their supGM-CSF is as potent in the differentiation of BMDCs and AMs as the commercially acquired GM-CSF. Furthermore, they show that the BMDCs and AMs developed show no changes in their immune signaling cascades. Overall, this is a very interesting study and this cell line could make the study of BMDCs and AMs more affordable and easier to do.

Points

1. As the authors are using a lentivirus to introduce the GM-CSF into the 293T cells. Do they know where the lentivirus integrated? Did they aim for a single integration or multiple integrations? If the lentivirus integrated in multiple sites, this may affect the stability of the line.

2. The authors should run a western blot showing that GM-CSF is at the proper molecular weight. This is particularly important as they transduced the 293T cells with a lentivirus. ELISAs do not tell you if the secreted GM-CSF is intact or fused with a protein at the site of the lentiviral intergration. Even if it is functionally active, showing that the GM-CSF secreted is at the right molecular weight and not fused with some cellular protein is of importance.

3. Line 102 “the following …mice” makes no sense. Please fix this part of the sentence

4. It is not clear in the figure legends or the text if the repeats of the BMDCs/BMDMs experiments (staining, response to LPS etc) were done using cells differentiated from one mouse or each repeat is BMDCs/DMs derived from a different mouse every time (i.e. cells from different mice are used for different repeats of the experiments). Please clarify.

5. In line 178 you say you use 10WT mice, but Figure 4A says 40. Which one is right?

Reviewer #2: The authors have generated and characterized a cell line that produces and secretes GM-CSF. This reagent may be useful to the field for use in lieu of purified recombinant GM-CSF to generate bone-marrow derived dendritic cells. This manuscript is suitable for publication in Plos ONE, and I have only a few comments/suggestions.

Line 80: “…depleted of erythrocytes.” How was this done? Lysis buffer or other method?

Line 81-82: “…supplemented with either 10% M-CSF from L929 cells, 5-10% supernatant, or 10-25ng/ml of recombinant mGM-CSF” To what cells does “5-10% supernatant” refer? I presume it is the 293T cells, but this should be clarified here.

Line 97: I suggest removing or replacing “inflammasome” in this method title because the activation of these cells includes LPS stimulation and does not appear to be specific to the inflammasome.

Line 117: add citation for “Chen et al. (PMID:3288696)” to references

Line 153: “…CD11c is a dendritic cell marker” CD11c is also expressed by some macrophages.

Line 164-165: “Dendritic cells differentiated with 10ng/ml GM-CSF show statistically higher mean fluorescence intensity for MHC class II for supGM-CSF in comparison to pGM-CSF”. The authors should cite Helft et al. (PMID: 26084029), which show that MHCII high population are more DC-like and the MHC-intermediate population is more macrophage-like. The differences noted by the authors in their comparisons may relate to these two distinct populations reported by Helft et al. to be present within the GM-CSF cultures.

Line 165-167: Although there is no difference in MFI overall, there appears to be a difference in proportion of MHCII-low/int cells between Fig. 3A and Fig. 3B.

Line 221: “…while this pathway is now contested in DCs our results for GM-CSF is true” The meaning of this statement is unclear.

Line 372: This extended method does not appear to be finalized. For example, there are ?’s remaining in the method text (line 381, 426, 436)

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: Robinson etal.docx

 10.1371/journal.pone.0249117.r002 Author response to Decision Letter 0 Submission Version 1

17 Dec 2020

See response to reviewers letter attached.

Submitted filename: Response to Reviewers_mGMCSF_2020.pdf

 10.1371/journal.pone.0249117.r003 Decision Letter 1 MacDuff Donna A. Academic Editor 2021 Donna A. MacDuff This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version 1

9 Feb 2021

PONE-D-20-18789R1

Generation and utilization of a HEK-293T murine GM-CSF expressing cell line

PLOS ONE

Dear Dr. Carpenter,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

Although you have addressed the reviewers' concerns, a question has arisen regarding adherence to PLoS ONE publication criteria for studies that describe new methods and tools as indicated here:

https://journals.plos.org/plosone/s/submission-guidelines

Specifically:

"Utility: The tool must be of use to the community and must present a proven advantage over existing alternatives, where applicable."

"Validation: If similar options already exist, the submitted manuscript must demonstrate that the new tool is an improvement over existing options in some way. This requirement may be met by including a proof-of-principle experiment or analysis; if this is not possible, a discussion of the possible application and some preliminary analysis may be sufficient".

Conditioned media from your new cell line is more cost-effective than commercially available rGM-CSF. However, an alternative cell line, J558L-GM-CSF, is available and still in use today for the purposes described in your study, despite the 1997 study that indicated possible detrimental secretion of IL-10. Such studies include:

https://www.sciencedirect.com/science/article/pii/S0092867417313880

https://bio-protocol.org/e3302 (reference 19)

https://www.sciencedirect.com/science/article/pii/S1931312818305419?via%3Dihub

Do you have experimental evidence that indicates that your cell lines produces conditioned media that is superior to that produced by the J558L cells line for the purpose of culturing BMDCs or alveolar macrophages? Is there evidence in the literature that J558L cell supernatant is problematic for the in vitro differentiation and culturing of the cell types used in your study?

"Availability: If the primary focus of a manuscript is the presentation of a new tool... it should be openly available under a license no more restrictive than CC BY." 

Will your 293T-GM-CSF cell line be made available to other investigators? If so, please include this information in the Data and Materials Availability section (lines 303-306).

"Cell lines: For established cell lines, the Methods section should include: ... The cell line repository or company the cell line was obtained from, the catalogue number, and whether the cell line was obtained directly from the repository/company or from another laboratory."

Please include this information in the Methods section. It will be particularly important for a reagent that may be used by other laboratories in the future. 

I apologize for the delay in returning this decision to you.

==============================

Please submit your revised manuscript by Mar 26 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Donna A. MacDuff, Ph.D

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

 10.1371/journal.pone.0249117.r004 Author response to Decision Letter 1 Submission Version 2

9 Mar 2021

Dear Editor,

We appreciate your time and continued interest in our manuscript. We believe we have addressed all the concerns to the best of our abilities. Below we outline our specific responses to the four main comments/concerns and kept the quoted submission guidelines in red. Overall we continue to believe that this work has the scientific merit to be published in PLOS One.

Editor Comments

Submission guidelines: "Utility: The tool must be of use to the community and must present a proven advantage over existing alternatives, where applicable."

Submission guidelines: "Validation: If similar options already exist, the submitted manuscript must demonstrate that the new tool is an improvement over existing options in some way. This requirement may be met by including a proof-of-principle experiment or analysis; if this is not possible, a discussion of the possible application and some preliminary analysis may be sufficient".

1. Conditioned media from your new cell line is more cost-effective than commercially available rGM-CSF. However, an alternative cell line, J558L-GM-CSF, is available and still in use today for the purposes described in your study, despite the 1997 study that indicated possible detrimental secretion of IL-10. Such studies include:

Our tool, HEK-293T mGM-CSF cells is much more advantageous than the existing alternatives. When assessing the main alternative, recombinant GM-CSF, our cell line is much more economical as well as more efficient (Fig. 2C). The recombinant GM-CSF is the gold standard when it comes to both culturing bone marrow-derived dendritic cells (BMDCs) (https://doi.org/10.1002/cpim.115) and alveolar macrophages (10.1084/jem.20131199, 10.1189/jlb.1107781, 10.1007/978-1-4939-6625-7_23). While J558L, a myeloma, mGM-CSF cell line exists and was created in 1988 (https://doi.org/10.1002/eji.1830180115), it has not replaced recombinant mGM-CSF when it comes to general in vitro studies. This is primarily due to the fact that the cell line is derived from a lymphoid (immune cell) and therefore can secrete more than just mGM-CSF into the supernatant from this cell line, including the incredibly important anti-inflammatory cytokine IL10 found in the 1997 study (10.1002/eji.1830270326). When this supernatant is then cultured with bone marrow to differentiate into BMDCs or fetal livers to differentiate alveolar macrophages, for instance, it will affect the transcriptional programming (immune signaling) leading to a switch of a pro-inflammatory to an anti-inflammatory state. Our cell line, HEK-293T mGM-CSF is much more advantageous because these cells are considered “empty” in that they do not express these immune chemokines and will not alter the state of immune cells.

From publicly available RNAseq datasets (https://www.proteinatlas.org/) [image below], we know that IL10 is not expressed in HEK-293T cell lines. This, in addition to how the cell line was generated and the cell type, makes our HEK-293T mGM-CSF cell line superior to the J558L mGM-CSF lymphoid expressing cell line.

At this moment, the only additional cytokine that is secreted in J558L and not HEK-293Ts is IL10. IL10 is a heavily studied cytokine, defined as a potent anti-inflammatory that plays a central role in limiting host immune response to pathogens, thereby preventing damage to the host and maintaining normal tissue homeostasis (PMID: 22428854). In DCs a study from the Gregori group showed that IL10 can lead to a very specific subset of DCs, coined DC-10 in humans (10.3389/fimmu.2018.00682). Another study, by the Staege group shows that IL10 changes both the phenotype and gene expression of BMDCs (PMID: 24222115).

Additionally, papers that were indicated as sources that use J558L can be misleading. This is because J558, originally generated in 1972 (10.1073/pnas.80.3.825), was further subcultured and a J558L cloned was identified and defined as a spontaneous heavy chain-loss-variant myeloma cell line and does not express GM-CSF (10.1073/pnas.80.3.825).

Now, we would now like to discuss the papers you cited. First, the Cell study by the Colonna group shows the use of J558L specifically as a cancer cell line (https://doi.org/10.1016/j.cell.2017.11.037). In this study, J558L was utilized as a cancer cell line to show the anti-cancer properties of NK cells and PDGF-DD with the presence of pro-inflammatory cytokines (TNFa or IFNg). This study is utilizing J558L which does not express GM-CSF, which again is being primarily used as a myeloma lymphoid cancer cell line to determine novel anticancer mechanisms. The cell line was not utilized to generate Alveolar Macrophages or Dendritic Cells. Therefore this use does not discount the value of our HEK-293T mGM-CSF cell line. Second, the Cell Host & Microbe study by the Nice group does utilize J588L mGM-CSF to generate DCs (https://doi.org/10.1016/j.chom.2018.10.003). In this study the entirety of the study was not in vitro, however, I would be very concerned about how a potent anti-inflammatory protein would affect the cytokine profile of a primary BMDC. This would be a huge caveat to the experiment. We understand the costliness of rGM-CSF and this may outweigh the experiment caveats if the proper controls are used. However, we believe that our tool would be greatly advantageous to all researchers performing in vitro studies on BMDCs and Alveolar Macrophages with an interest in pro-inflammatory signaling. The final paper that was cited by you the editor was a 2019 study, our reference 19, showing the use of J558L mGM-CSF to culture alveolar macrophages (10.21769/BioProtoc.3302) from bronchiolar lavage (BAL) fluid. This protocol’s main aim is to determine the best way to harvest the highest number of alveolar macrophages by assessing temperature and FCS or EDTA concentration in the media used to perform BALs. The cultured primary alveolar macrophages were then counted, the activity of these cells was never measured. Thus the caveat of the IL-10 expression was not considered as critical and J558L was used instead of the recombinant GM-CSF standard. Therefore in conclusion we believe our tool is worth publishing in PLOS One and available as the new gold standard that will be a cheaper and overall more efficient alternative to rGM-CSF and does not come with the caveats of inflammatory cytokines as are associated with the J558L.

2. Do you have experimental evidence that indicates that your cell lines produce conditioned media that is superior to that produced by the J558L cell line for the purpose of culturing BMDCs or alveolar macrophages? Is there evidence in the literature that J558L cell supernatant is problematic for the in vitro differentiation and culturing of the cell types used in your study?

We were primarily interested in making sure that our cell line was more advantageous when compared to the gold-standard of BMDC or Alveolar Macrophage in vitro work. We chose to focus on making the comparison of our line to the most utilized alternative in the field with his recombinant GM-CSF. Given the caveats outlined above with the J558 line producing cytokines like IL10, we did not consider it to be the best comparison to make as it is will be clear to immunologists interested in studying signaling that J558L is just not an option for use in such studies. We also already know that the J588L cell line expresses immune proteins, including the anti-inflammatory protein IL10 (10.1002/eji.1830270326).

Submission guidelines: "Availability: If the primary focus of a manuscript is the presentation of a new tool... it should be openly available under a license no more restrictive than CC BY."

3. Will your 293T-GM-CSF cell line be made available to other investigators? If so, please include this information in the Data and Materials Availability section (lines 303-306).

This is a very important point. We would like to share that this cell line is available upon request. Since being published in bioRxiv, July 2020, our cell line has been sent to 4 separate labs for both culturing BMDCs and primary Alveolar Macrophages. The ‘Data and Materials Availability’ section has been amended (lines 305-306).

Submission guidelines: "Cell lines: For established cell lines, the Methods section should include: ... The cell line repository or company the cell line was obtained from, the catalogue number, and whether the cell line was obtained directly from the repository/company or from another laboratory."

4. Please include this information in the Methods section. It will be particularly important for a reagent that may be used by other laboratories in the future.

Material and Methods amended for HEK-293T cell line, line 70.

Submitted filename: Response to Reviewers.pdf

 10.1371/journal.pone.0249117.r005 Decision Letter 2 MacDuff Donna A. Academic Editor 2021 Donna A. MacDuff This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version 2

12 Mar 2021

Generation and utilization of a HEK-293T murine GM-CSF expressing cell line

PONE-D-20-18789R2

Dear Dr. Carpenter,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Donna A. MacDuff, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

 10.1371/journal.pone.0249117.r006 Acceptance letter MacDuff Donna A. Academic Editor 2021 Donna A. MacDuff This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

31 Mar 2021

PONE-D-20-18789R2

Generation and utilization of a HEK-293T murine GM-CSF expressing cell line

Dear Dr. Carpenter:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Donna A. MacDuff

Academic Editor

PLOS ONE