PLoS Pathog plos plospath PLoS Pathogens 1553-7366 1553-7374 Public Library of Science San Francisco, USA PPATHOGENS-D-14-00795 10.1371/journal.ppat.1004126 Correction Correction: Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene The PLOS Pathogens Staff 42014 1642014 10 4 e1004126 2014 The PLOS Pathogens StaffThis is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene <p>There are data and labeling errors in <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref>. In the original <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref>, the gel image for <italic>Os07g06970</italic> is incorrect. It is a duplicate of the image for <italic>Os01g40290</italic>. The new <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref> contains the correct image. Also, the original <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref> was generated using Locus IDs from Release 5.0 of the Rice Genome Annotation Project. Relative to Release 7.0, used for all other reporting in the article, one of these Locus IDs, <italic>Os10g38495</italic>, is obsolete. It has been updated in the new <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref> to the corresponding Release 7.0 Locus ID, <italic>Os10g38489</italic>. The remaining Locus IDs are the same in Release 5.0 and Release 7.0 and unchanged in the new <xref ref-type="fig" rid="ppat-1004126-g001">Figure 3</xref>.</p> <fig id="ppat-1004126-g001" position="float"><object-id pub-id-type="doi">10.1371/journal.ppat.1003972.g003</object-id><label>Figure 3</label><caption> <title>Type III secretion system dependence of the most significant rice gene expression changes.

RT-PCR results reflecting transcript abundance are shown for rice genes identified by GeneChip expression analysis as the ten (or fewer) most significantly differentially expressed in response to (A) X. oryzae pv. oryzicola BLS256 (Xoc), (B) X. oryzae pv. oryzae strain PXO99A (Xoo), (C) Xoc and Xoo similarly, or (D) Xoc and Xoo to different extents. Leaf samples were harvested at 36 hours after inoculation with wild-type strains or with the type III secretion (T3S−) deficient derivatives. RT-PCR results for previously reported Xoo-induced genes, OsSWEET11 and TFIIAγ1 [9], [10], are omitted. An actin gene (Os04g57210) that is not differentially expressed was used as a reference for relative transcript abundance across samples. The experiment was repeated twice and yielded the same results.

Please see the corrected Figure 3 here. The legend remains unchanged.

There is an error in Figure 2, Table S1, Table S6, and Table S9. Release 7.0 Locus ID Os10g38489 correctly corresponds to Os10g38495 from Release 5.0, i.e. to probeset Os.2612.1.S1_at. However, the Release 7.0 Locus ID recorded for data associated with this probeset in Figure 2, Table S1, Table S6, and Table S9 is the paralog Os10g38640 and is incorrect. Os.2612.1.S1_at does not represent Os10g38640. Os10g38640 should be replaced with Os10g38489 in Figure 2, Table S1, Table S6, and Table S9, in each of which it occurs exactly once. The primers listed for Os10g38640 in Table S9 correspond uniquely to Os10g38489. They were designed for the Release 5.0 gene model at that coordinate, Os10g38495, and should be left unchanged.

There is an additional error in Figure 2 and Table S1, that is also in Table S4. In Figure 2, Table S1, and Table S4, the Release 7.0 Locus ID recorded for data associated with probeset Os.46631.1.S1_x_at is Os07g29750 and is incorrect. Os.46631.1.S1_x_at does not represent Os07g29750. The correct Locus ID for Os.46631.1.S1_x_at is the paralog Os10g39840. Os10g39840 is unchanged from Release 5.0 to Release 7.0 and appears correctly in Figure 3. Os07g29750 should be replaced with Os10g39840 in Figure 2, Table S1, and Table S4, in each of which it occurs exactly once.

There is additional information to add to Table S9. Primers used to amplify Os10g39840 (to generate the corresponding data in Figure 3) are (5’ to 3’) forward primer CCGATCAGGAGGTACGAGAAGAAGG and reverse primer GCACGCCTCAACTACCAAATTGC.

There are two errors in Table 1 and Table S7. Os10g38489, unlike Os10g38640, is a predicted target, displaying a candidate EBE for Tal1b of Xoc. Os10g38489 with associated data is added to the corrected Table 1 and corrected Table S7. Os07g29750 is incorrectly included in Table 1 and Table S7 as a predicted target of Xoc Tal4c. Based on the probeset that correctly maps to Os07g29750, OsAffx16482.1.S1_x_at, Os07g29750 is not differentially expressed in any pairwise comparison, and therefore would not be considered a predicted target, despite its candidate EBE for Tal4c. Os07g29750 is removed from the new Table 1 and Table S7. It is not be replaced in these tables with Os10g39840 because Os10g39840 displays no candidate EBE for any Xoc TAL effector. There is therefore no net change in the total number of predicted targets.

10.1371/journal.ppat.1003972.t001 Predicted <italic>X. oryzae</italic> pv. oryzicola BL256 TAL effector targets in rice (cv. Nipponbare) induced during infection and results of verification experiments.<xref ref-type="table-fn" rid="nt101">a</xref>
TAL effector Target Locus IDb Probe set ID(s) Fold change 2-96h Xocc Fold change Mock-Xoc 96hd q (Mock- Xoc)e EBE Scoref EBE rel. scoreg EBE rankh EBE to TLSi EBE to TXSj EBE to TATA boxk EBE to Y patchl Induced by Description
tal gene knockout strain of Xocl Xag expressing the tal genem
Tal4a 01g27210 Os.7911.1.S1_at 1.63 1.66 1.8E-01 29.22 2.85 341 253 143 -50 none + - Glutathione S-transferase, putative, expressed
Tal6 01g31220 Os.6438.1.S1_a_at Os.6438.2.S1_x_at 1.48 1.48 1.53 1.52 8.0E-02 1.1E-02 18.75 2.38 685 157 152 none 33 - + Expressed protein
Tal2d 01g51040 Os.53457.1.S1_at 2.30 2.23 1.9E-01 14.32 2.19 324 527 none -328 0 + - Transmembrane protein 16K, putative, expressed
Tal9b 01g51040 Os.53457.1.S1_at 2.30 2.23 1.9E-01 14.07 2.81 275 18 0 -299 none - + Transmembrane protein 16K, putative, expressed
Tal2g 01g52130 Os.41841.1.S1_at 13.00 9.59 1.3E-06 13.94 1.97 77 427 58 28 none - + Sulfate transporter, putative, expressed
Tal3b 01g53220 Os.35681.1.S1_at 3.50 4.12 2.2E-06 17.72 2.92 611 146 -5 -137 none nd nd HSF-type DNA-binding domain containing protein, expressed
Tal6 02g14770 Os.2450.1.S1_a_at Os.2450.3.S1_x_at 1.88 1.85 1.77 1.55 1.3E-02 6.8E-02 18.48 2.35 569 92 48 -70 -37 + - Phosphoenolpyruvate carboxylase, putative, expressed
Tal11a 02g15290 Os.56119.1.S1_at 1.72 4.93 4.1E-07 20.15 3.18 582 422 none -288 none + - VQ domain containing protein, putative, expressed
Tal5a 02g15290 Os.56119.1.S1_at 1.72 4.93 4.1E-07 23.32 1.88 107 148 30 -3 -180 - + VQ domain containing protein, putative, expressed
Tal7 02g15710 OsAffx.2629.1.S1_at 5.70 5.52 8.4E-02 15.75 1.94 265 951 none 150 434 nd nd Plastocyanin-like domain containing protein, putative, expressed
Tal3b 02g34970 Os.47735.1.S1_at 9.07 5.31 4.0E-07 15.33 2.53 75 110 29 -282 none - + No apical meristem protein, putative, expressed
Tal2a 02g43760 Os.1349.1.S1_at OsAffx.2950.1.S1_s_at 1.25 1.23 1.45 1.32 1.7E-03 5.3E-03 15.87 1.75 21 521 none -334 -5 nd + Ubiquitin carboxyl-terminal hydrolase, family 1, putative, expressed
Tal7 02g43760 Os.1349.1.S1_at OsAffx.2950.1.S1_s_at 1.25 1.23 1.45 1.32 1.7E-03 5.3E-03 16.45 2.03 547 628 341 17 117 + - Ubiquitin carboxyl-terminal hydrolase, family 1, putative, expressed
Tal3c 02g47660 Os.7751.1.S1_at 2.25 2.24 1.9E-03 10.93 1.92 53 140 -63 -98 none - + Basic helix-loop-helix, putative, expressed
Tal4c 02g47660 Os.7751.1.S1_at 2.25 2.24 1.9E-03 24.73 3.01 434 367 310 -25 none + - Basic helix-loop-helix, putative, expressed
Tal2c 03g03034 Os.10510.1.S1_at Os.53217.1.S1_x_at 1.49 1.26 3.11 2.83 1.1E-02 6.8E-02 19.55 1.83 0 142 114 -779 6 - + Flavonol synthase/flavanone 3-hydroxylase, putative, expressed
Tal3b 03g03034 Os.10510.1.S1_at Os.53217.1.S1_x_at 1.49 1.26 3.11 2.83 1.1E-02 6.8E-02 16.73 2.76 258 759 567 none none + - Flavonol synthase/flavanone 3-hydroxylase, putative, expressed
Tal11a 03g05370 OsAffx.24978.1.S1_at 10.98 13.02 5.2E-04 17.39 2.74 307 798 331 526 none + - Expressed protein
Tal3c 03g07540 OsAffx.3165.1.S1_at 6.33 3.84 3.6E-02 12.33 2.17 350 248 99 -625 none - + bHLH family protein, putative, expressed
Tal7 03g25490 Os.34992.2.S1_at 2.10 2.02 3.8E-05 16.32 2.01 494 199 30 -363 9 + - Cytochrome P450 72A1, putative, expressed
Tal4a 03g37840 Os.20541.1.S1_at 2.24 1.96 2.2E-04 15.58 1.52 0 362 151 -3 none - + Potassium transporter, putative, expressed
Tal2d 04g49194 Os.17316.1.S1_at 22.42 10.49 3.9E-07 8.22 1.26 0 101 26 -715 none - + Naringenin,2-oxoglutarate 3-dioxygenase, putative, expressed
Tal3a 05g12450 OsAffx.26856.1.S1_at 1.81 1.34 2.3E-01 16.07 2.01 294 446 315 none none + - Hydroquinone glucosyltransferase, putative, expressed
Tal3b 05g27590 Os.57186.1.S1_at 2.40 4.42 3.4E-08 11.40 1.88 2 103 33 -1 none - + Wound-induced protein WI12, putative, expressed
Tal11b 06g14750 OsAffx.15432.1.S1_at 1.29 1.30 2.0E-01 12.44 2.77 129 313 195 160 -15 + - Phosphatidylinositol-4-phosphate 5-Kinase family protein, putative, expressed
Tal1c 06g14750 OsAffx.15432.1.S1_at 1.29 1.30 2.0E-01 12.00 2.44 256 178 47 none none + - Phosphatidylinositol-4-phosphate 5-Kinase family protein, putative, expressed
Tal2a 06g14750 OsAffx.15432.1.S1_at 1.29 1.30 2.0E-01 17.59 1.94 88 79 -22 -618 -33 nd - Phosphatidylinositol-4-phosphate 5-Kinase family protein, putative, expressed
Tal4c 06g37080 Os.16282.1.A1_at OsAffx.15788.1.S1_at 5.54 11.84 7.15 9.94 2.7E-10 6.3E-09 14.64 1.78 0 150 39 -1 none - + L-ascorbate oxidase precursor, putative, expressed
Tal8 06g37080 Os.16282.1.A1_at OsAffx.15788.1.S1_at 5.54 11.84 7.15 9.94 2.7E-10 6.3E-09 19.92 2.32 605 661 560 -36 548 + - L-ascorbate oxidase precursor, putative, expressed
Tal2g 06g46500 Os.49496.1.S1_at 6.40 6.88 4.3E-08 14.27 2.01 117 89 59 -489 -47 - + Monocopper oxidase, putative, expressed
Tal11a 06g47950 OsAffx.15977.1.S1_s_at 1.78 1.67 2.8E-02 16.20 2.55 19 527 none -328 0 nd nd Tetratricopeptide-like helical, putative, expressed
Tal1c 07g06970 Os.49794.1.S1_at 2.95 2.27 1.3E-02 5.97 1.22 0 216 24 none none - + HEN1, putative, expressed
Tal3a 07g06970 Os.49794.1.S1_at 2.95 2.27 1.3E-02 16.21 2.03 354 930 815 444 none + - HEN1, putative, expressed
Tal4b 07g34510 Os.51294.1.S1_at 0.95 1.00 2.8E-01 8.88 1.63 33 302 151 -425 none nd nd Retrotransposon protein, putative, unclassified, expressed
Tal3b 07g36430 Os.31021.1.S1_at 2.53 2.40 2.6E-02 15.78 2.6 108 117 31 -4 none - + Expressed protein
Tal6 07g47790 Os.8920.1.S1_at 4.16 8.41 3.6E-02 13.38 1.7 8 798 610 -192 694 + - AP2 domain containing protein, expressed
Tal4a 09g20220 Os.4759.1.S1_at 2.17 2.38 4.9E-02 28.93 2.83 280 170 139 -751 34 + - Glutathione S-transferase, putative, expressed
Tal2d 09g23560 Os.5983.1.S1_at 2.19 5.02 2.8E-01 14.19 2.17 288 525 none none 93 nd nd Dehydrogenase, putative, expressed
Tal6 09g29100 Os.18607.1.S1_at 1.64 1.97 3.6E-02 17.00 2.13 167 0 0 0 0 - + Cyclin, putative, expressed
Tal4b 09g32100 Os.16365.1.S1_at 3.34 2.45 8.0E-03 8.15 1.5 16 270 84 21 none - + Expressed protein
Tal1b 10g38489 Os.2612.1.S1_at 4.75 4.14 4.00E-07 8.75 4.13 325 64 20 none none nt nt glutathione S-transferase GSTU6, putative, expressed
Tal9a 11g01480 Os.18448.1.S1_s_at OsAffx.30765.1.S1_at 5.42 5.74 3.94 4.10 8.2E-06 5.4E-06 19.71 2.56 206 776 621 365 none + - MYB family transcription factor, putative, expressed
Tal9a 12g01490 Os.18448.1.S1_at 5.21 3.92 2.6E-05 19.71 2.56 205 302 191 151 none + - MYB family transcription factor, putative, expressed
Tal6 12g42970 Os.11382.1.S1_at 2.31 1.65 2.2E-04 16.84 2.14 139 132 30 -565 12 - + GATA zinc finger domain containing protein, expressed
Tal6 12g42970 Os.11382.1.S1_at 2.31 1.65 2.2E-04 18.27 2.32 411 107 5 -590 -13 - + GATA zinc finger domain containing protein, expressed

Expression values are from the GeneChip expression experiment; see Materials and Methods.

Prefix “LOC_Os” is omitted.

Fold change in transcript abundance in leaves at 96h relative to 2h after inoculation with X. oryzae pv. oryzicola BLS256 (Xoc).

Fold change in transcript abundance at 96h in Xoc-inoculated leaves relative to mock-inoculated leaves.

Calculated for the comparison of transcript abundance in Xoc vs. mock inoculated leaves across all time points.

Score is according to Doyle et al. [32] except that new RVDs ‘SN’ and ‘YG’, present in Tal2g, were assigned nucleotide association frequencies of ‘NN’ and ‘NG’, respectively (see text).

EBE relative score, ratio of the observed EBE score to the best possible score for the TAL effector [32].

EBE rank among the single best scoring sites for the TAL effector in each rice promoter [32].

Distance in bases from the 5' end of the EBE to the translational start site (TLS) of the target locus; a positive value indicates a location downstream of the EBE.

Distance in bases from the 5' end of the EBE to the transcriptional start site (TXS) based on cDNA evidence in the Rice Genome Annotation Project Release 7 (http://rice.plantbiology.msu.edu/); a positive value indicates a location downstream of the EBE; none, cDNA evidence of TXS missing.

Distance in bases from the 5' end of the EBE to the nearest identified putative TATA box; a positive value indicates a location downstream of the EBE; none, putative TATA box not present.

Distance in bases from the 5' end of the EBE to the nearest identified putative Y patch; a positive value indicates a location downstream of the EBE; none, putative Y patch not present.

Results of RT-PCR 48h after inoculation, relative to a negative control inoculation (see Supplemental Figure S1); Xoc, X. oryzae pv. oryzicola BLS256; Xag, X. axonopodis pv glycines EB08; +, induced; -, not induced; nd, transcript not detected by RT-PCR (in each case, amplification by standard PCR from genomic DNA as template was confirmed); nt, not tested.

The corrected Table 1 can be seen here.

The corrected Table S7 can be downloaded here. The legend remains unchanged.

 Supporting Information

All computationally predicted targets in rice (cv. Nipponbare) of TAL effectors of Xanthomonas oryzae pv. oryzicola BLS256 (Xoc) and TAL effectors of Xanthomonas oryzae pv. oryzae PXO99A (Xoo).

(XLSX)

 Reference CernadasRA, DoyleEL, Niño-LiuDO, WilkinsKE, BancroftT, et al. (2014) Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene. PLoS Pathog 10(2): e1003972 doi:10.1371/journal.ppat.1003972