Class org.broadinstitute.hellbender.tools.funcotator.ProteinChangeInfoUnitTest

20:26:00.669 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.670 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.670 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
20:26:00.670 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.670 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.670 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.670 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.671 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.671 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.671 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
20:26:00.672 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.672 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.672 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
20:26:00.672 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.672 WARN  FuncotatorUtils - Unexpected codon sequence: NTC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.672 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: NTCATTTACCCGTAG
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: TNT   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.673 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: NTA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.673 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.673 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.674 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.674 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.674 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.674 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.674 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.674 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.674 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: NTA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: NCA   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  FuncotatorUtils - Unexpected codon sequence: TNT   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.675 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: TNC   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: ATN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATCATNTACCCGTAG
20:26:00.676 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, ref allele: A)
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, alt allele: ATCACTG)
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.676 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATGGAGGACGACTCACTCTACTTGGGAGGTGAGTGGCAGTTCAACCACTTTTCAAAACTCACATCTTCTCGGCCCGATGCAGCTTTTGCTGAAATCCAGCGGACTTCTCTCCCTGAGAAGTCACCACTCTCATGTGAGACCCGTGTCGACCTCTGTGATGATTTGGCTCCTGTGGCAAGACAGCTTGCTCCCAGGGAGAAGCTTCCTCTGAGTAGCAGGAGACCTGCTGCGGTGGGGGCTGGGCTCCAGAATATGGGAAATACCTGCTACGTGAACGCTTCCTTGCAGTGCCTGACATACACACCGCCCCTTGCCAACTACATGCTGTCCCGGGAGCACTCTCAAACGTGTCATCGTCACAAGGGCTGCATGCTCTGTACGATGCAAGCTCACATCACACGGGCCCTCCACAATCCTGGCCACGTCATCCAGCCCTCACAGGCATTGGCTGCTGGCTTCCATAGAGGCAAGCAGGAAGATGCCCATGAATTTCTCATGTTCACTGTGGATGCCATGGAAAAGGCATGCCTTCCCGGGCACAAGCAGGTAGATCNNNNNNN
20:26:00.677 WARN  FuncotatorUtils - createAminoAcidSequence given a coding sequence of length not divisible by 3.  Dropping bases from the end: 2 (size=560, ref allele: A)
20:26:00.677 WARN  FuncotatorUtils - Unexpected codon sequence: CNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.677 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.677 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.677 WARN  FuncotatorUtils - Unexpected codon sequence: NNN   -   Cannot create protein prediction.  This may be due to "N" (or other IUPAC) bases in the Reference or the current variant's alleles.
20:26:00.677 WARN  ProteinChangeInfo - Ref protein sequence is undecodable: ATGGAGGACGACTCACTCTACTTGGGAGGTGAGTGGCAGTTCAACCACTTTTCAAAACTCACATCTTCTCGGCCCGATGCAGCTTTTGCTGAAATCCAGCGGACTTCTCTCCCTGAGAAGTCACCACTCTCATGTGAGACCCGTGTCGACCTCTGTGATGATTTGGCTCCTGTGGCAAGACAGCTTGCTCCCAGGGAGAAGCTTCCTCTGAGTAGCAGGAGACCTGCTGCGGTGGGGGCTGGGCTCCAGAATATGGGAAATACCTGCTACGTGAACGCTTCCTTGCAGTGCCTGACATACACACCGCCCCTTGCCAACTACATGCTGTCCCGGGAGCACTCTCAAACGTGTCATCGTCACAAGGGCTGCATGCTCTGTACGATGCAAGCTCACATCACACGGGCCCTCCACAATCCTGGCCACGTCATCCAGCCCTCACAGGCATTGGCTGCTGGCTTCCATAGAGGCAAGCAGGAAGATGCCCATGAATTTCTCATGTTCACTGTGGATGCCATGGAAAAGGCATGCCTTCCCGGGCACAAGCAGGTAGATCNNNNNNN